Rmu_sc0000405.1_g000011
NAC Family

NAC domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000405.1
OG0018470
Physical Location & Seq
Forward (+)
59539 .. 60411
873 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000405.1_g000011.1.cds

Sequence Viewer

Length: 717 bp
atgaacggaggaggaggagtgcagatgctgccagttggctaccggtttgatccgacggatgaggagcttgtggttcactacttgaggagaaaggtccatggcctcccactgccggcttccatcattcccgactataacaacaactactactttgatcatccctcccacctgccaatgcctccaggcgagaccatgcaaaagaggtacttcttctacaatagtgaatataatgatgaaaaaagtaagaagaacaacaaccgcagtaactataagagggctgctgctgctgctggttgtggttcttggaggtctattgggaaagagaagcaaattgttgctactactcattctgatcatcaaagcagctgcagccaagctcaattagctgtccttggggtgaggaaaaccttggttttctgcggcagccacaggaagaaggagactaagcaccactaccactaccaacatcaatatggaagcctcagtagtagccctcgatggttcatgcatgaatataaccttcttggttctgaggtgttaggaaacagctggattctgtgtagtgtatttcagaagaggagaaagcctgcgagcaagaaaagaggtcggacctcaactttggatattacaggatcaggctatcttcccaaaccttccaattcatgttcgagtgaaatcactactgacgatcaggaggtcttttccaaatgttattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM

Protein Analysis

238

Amino Acids

27.09

Weight (kDa)

9.4

Isoelectric Point (pI)

60.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018470)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g54000
rosa_chinensis RchiOBHm_Chr2g0176181
rosa_laevigata RLG00000022387
rosa_multiflora Rmu_sc0000405.1_g000011
rosa_roxburghii Rroxscaffold_2G00076700
rosa_rugosa Rorug02G0591300
rosa_samantha Rh2BG681500 Rh2CG644400 Rh2DG695200
rosa_wichuraiana Rw2G054960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 177
Acc36I ACCTGC 1 cut(s) 177
AciI CCGC 2 cut(s) 259, 420
AclWI GGATC 2 cut(s) 44, 640
AfaI GTAC 1 cut(s) 206
AfiI CCNNNNNNNGG 1 cut(s) 112
AgeI ACCGGT 1 cut(s) 42
AjnI CCWGG 1 cut(s) 181
AluBI AGCT 5 cut(s) 67, 366, 377, 386, 549
AluI AGCT 5 cut(s) 67, 366, 377, 386, 549
Alw26I GTCTC 2 cut(s) 182, 434
AlwI GGATC 2 cut(s) 44, 640
AlwNI CAGNNNCTG 1 cut(s) 28
AoxI GGCC 1 cut(s) 100
ApeKI GCWGC 9 cut(s) 28, 278, 281, 284, 287, 363, 366, 369, 423
ArsI GACNNNNNNTTYG 2 cut(s) 601, 633
AsiGI ACCGGT 1 cut(s) 42
AspS9I GGNCC 2 cut(s) 94, 609
AsuHPI GGTGA 1 cut(s) 409
AvaII GGWCC 2 cut(s) 94, 609
BbvI GCAGC 9 cut(s) 15, 265, 268, 271, 274, 353, 375, 381, 435
BccI CCATC 2 cut(s) 128, 492
BciT130I CCWGG 1 cut(s) 183
BclI TGATCA 2 cut(s) 154, 352
BcoDI GTCTC 2 cut(s) 182, 434
BfmI CTRYAG 1 cut(s) 367
BfuAI ACCTGC 1 cut(s) 177
Bme1390I CCNGG 1 cut(s) 183
Bme18I GGWCC 2 cut(s) 94, 609
BmgT120I GGNCC 2 cut(s) 94, 609
BmrFI CCNGG 1 cut(s) 183
BmsI GCATC 1 cut(s) 15
BpmI CTGGAG 1 cut(s) 165
BpuEI CTTGAG 1 cut(s) 103
BsaI GGTCTC 1 cut(s) 182
BsaJI CCNNGG 3 cut(s) 97, 391, 408
BsaWI WCCGGW 1 cut(s) 42
BsaXI ACNNNNNCTCC 1 cut(s) 33
Bsc4I CCNNNNNNNGG 1 cut(s) 112
Bse118I RCCGGY 2 cut(s) 42, 112
Bse1I ACTGG 1 cut(s) 32
BseBI CCWGG 1 cut(s) 183
BseDI CCNNGG 3 cut(s) 97, 391, 408
BseGI GGATG 2 cut(s) 64, 157
BseLI CCNNNNNNNGG 1 cut(s) 112
BseMII CTCAG 2 cut(s) 496, 522
BseNI ACTGG 1 cut(s) 32
BseRI GAGGAG 6 cut(s) 24, 27, 30, 77, 100, 592
BseXI GCAGC 9 cut(s) 15, 265, 268, 271, 274, 353, 375, 381, 435
BsgI GTGCAG 1 cut(s) 41
BshFI GGCC 1 cut(s) 102
BshTI ACCGGT 1 cut(s) 42
BsiSI CCGG 2 cut(s) 43, 113
BslI CCNNNNNNNGG 1 cut(s) 112
BsmAI GTCTC 2 cut(s) 182, 434
BsnI GGCC 1 cut(s) 102
Bso31I GGTCTC 1 cut(s) 182
Bsp143I GATC 5 cut(s) 49, 154, 352, 632, 688
Bsp19I CCATGG 1 cut(s) 97
BspACI CCGC 2 cut(s) 259, 420
BspANI GGCC 1 cut(s) 102
BspCNI CTCAG 2 cut(s) 495, 523
BspMAI CTGCAG 1 cut(s) 371
BspMI ACCTGC 1 cut(s) 177
BspPI GGATC 2 cut(s) 44, 640
BspTNI GGTCTC 1 cut(s) 182
BsrFI RCCGGY 2 cut(s) 42, 112
BsrI ACTGG 1 cut(s) 32
BssAI RCCGGY 2 cut(s) 42, 112
BssECI CCNNGG 3 cut(s) 97, 391, 408
BssMI GATC 5 cut(s) 49, 154, 352, 632, 688
BssT1I CCWWGG 3 cut(s) 97, 391, 408
Bst2UI CCWGG 1 cut(s) 183
Bst6I CTCTTC 1 cut(s) 569
BstAPI GCANNNNNTGC 1 cut(s) 28
BstC8I GCNNGC 3 cut(s) 114, 588, 592
BstDEI CTNAG 3 cut(s) 444, 482, 531
BstDSI CCRYGG 1 cut(s) 97
BstF5I GGATG 2 cut(s) 64, 157
BstKTI GATC 5 cut(s) 52, 157, 355, 635, 691
BstMAI GTCTC 2 cut(s) 182, 434
BstMBI GATC 5 cut(s) 49, 154, 352, 632, 688
BstMWI GCNNNNNNNGC 5 cut(s) 28, 284, 287, 369, 383
BstNI CCWGG 1 cut(s) 183
BstSCI CCNGG 1 cut(s) 181
BstSFI CTRYAG 1 cut(s) 367
BstV1I GCAGC 9 cut(s) 15, 265, 268, 271, 274, 353, 375, 381, 435
BsuRI GGCC 1 cut(s) 102
BtgI CCRYGG 1 cut(s) 97
BtsCI GGATG 2 cut(s) 64, 157
BtsI GCAGTG 1 cut(s) 107
BtsIMutI CAGTG 1 cut(s) 107
BveI ACCTGC 1 cut(s) 177
Cac8I GCNNGC 3 cut(s) 114, 588, 592
CaiI CAGNNNCTG 1 cut(s) 28
Cfr10I RCCGGY 2 cut(s) 42, 112
Cfr13I GGNCC 2 cut(s) 94, 609
Csp6I GTAC 1 cut(s) 205
CspAI ACCGGT 1 cut(s) 42
CviAII CATG 5 cut(s) 98, 193, 505, 509, 663
CviQI GTAC 1 cut(s) 205
DdeI CTNAG 3 cut(s) 444, 482, 531
DpnI GATC 5 cut(s) 51, 156, 354, 634, 690
DpnII GATC 5 cut(s) 49, 154, 352, 632, 688
Eam1104I CTCTTC 1 cut(s) 569
EarI CTCTTC 1 cut(s) 569
Eco130I CCWWGG 3 cut(s) 97, 391, 408
Eco31I GGTCTC 1 cut(s) 182
Eco47I GGWCC 2 cut(s) 94, 609
EcoRII CCWGG 1 cut(s) 181
EcoT14I CCWWGG 3 cut(s) 97, 391, 408
EcoT22I ATGCAT 1 cut(s) 510
ErhI CCWWGG 3 cut(s) 97, 391, 408
FaeI CATG 5 cut(s) 101, 196, 508, 512, 666
FalI AAGNNNNNCTT 2 cut(s) 191, 223
FatI CATG 5 cut(s) 97, 192, 504, 508, 662
FbaI TGATCA 2 cut(s) 154, 352
FokI GGATG 2 cut(s) 71, 144
GsuI CTGGAG 1 cut(s) 165
HaeIII GGCC 1 cut(s) 102
HapII CCGG 2 cut(s) 43, 113
Hin1II CATG 5 cut(s) 101, 196, 508, 512, 666
HinfI GANTC 1 cut(s) 553
HpaII CCGG 2 cut(s) 43, 113
HphI GGTGA 1 cut(s) 409
Hpy166II GTNNAC 1 cut(s) 76
Hpy188I TCNGA 5 cut(s) 54, 352, 532, 573, 609
Hpy188III TCNNGA 2 cut(s) 128, 692
Hpy8I GTNNAC 1 cut(s) 76
Hpy99I CGWCG 1 cut(s) 58
HpyAV CCTTC 3 cut(s) 430, 530, 663
HpyCH4V TGCA 4 cut(s) 22, 196, 369, 508
HpyF10VI GCNNNNNNNGC 5 cut(s) 28, 284, 287, 369, 383
HpyF3I CTNAG 3 cut(s) 444, 482, 531
Hsp92II CATG 5 cut(s) 101, 196, 508, 512, 666
KroI GCCGGC 1 cut(s) 112
KroNI GCCGGC 1 cut(s) 114
Ksp22I TGATCA 2 cut(s) 154, 352
Kzo9I GATC 5 cut(s) 49, 154, 352, 632, 688
LmnI GCTCC 1 cut(s) 64
Lsp1109I GCAGC 9 cut(s) 15, 265, 268, 271, 274, 353, 375, 381, 435
LweI GCATC 1 cut(s) 15
MaeIII GTNAC 1 cut(s) 263
MalI GATC 5 cut(s) 51, 156, 354, 634, 690
MboI GATC 5 cut(s) 49, 154, 352, 632, 688
MboII GAAGA 5 cut(s) 202, 259, 445, 586, 635
MluCI AATT 3 cut(s) 330, 380, 658
MmeI TCCRAC 2 cut(s) 77, 587
Mph1103I ATGCAT 1 cut(s) 510
MroNI GCCGGC 1 cut(s) 112
MslI CAYNNNNRTG 1 cut(s) 471
MspA1I CMGCKG 2 cut(s) 366, 549
MspI CCGG 2 cut(s) 43, 113
MspR9I CCNGG 1 cut(s) 183
MvaI CCWGG 1 cut(s) 183
MwoI GCNNNNNNNGC 5 cut(s) 28, 284, 287, 369, 383
NaeI GCCGGC 1 cut(s) 114
NcoI CCATGG 1 cut(s) 97
NdeII GATC 5 cut(s) 49, 154, 352, 632, 688
NgoMIV GCCGGC 1 cut(s) 112
NlaIII CATG 5 cut(s) 101, 196, 508, 512, 666
NsiI ATGCAT 1 cut(s) 510
PaqCI CACCTGC 1 cut(s) 177
PdiI GCCGGC 1 cut(s) 114
PfeI GAWTC 1 cut(s) 553
PinAI ACCGGT 1 cut(s) 42
Psp6I CCWGG 1 cut(s) 181
PspGI CCWGG 1 cut(s) 181
PspPI GGNCC 2 cut(s) 94, 609
PstI CTGCAG 1 cut(s) 371
PstNI CAGNNNCTG 1 cut(s) 28
PvuII CAGCTG 2 cut(s) 366, 549
RsaI GTAC 1 cut(s) 206
RsaNI GTAC 1 cut(s) 205
RseI CAYNNNNRTG 1 cut(s) 471
Sau3AI GATC 5 cut(s) 49, 154, 352, 632, 688
Sau96I GGNCC 2 cut(s) 94, 609
ScrFI CCNGG 1 cut(s) 183
SfaNI GCATC 1 cut(s) 15
SfcI CTRYAG 1 cut(s) 367
SinI GGWCC 2 cut(s) 94, 609
SmiMI CAYNNNNRTG 1 cut(s) 471
SmlI CTYRAG 1 cut(s) 82
SmoI CTYRAG 1 cut(s) 82
Sse9I AATT 3 cut(s) 330, 380, 658
SsiI CCGC 2 cut(s) 259, 420
StyD4I CCNGG 1 cut(s) 181
StyI CCWWGG 3 cut(s) 97, 391, 408
TaqI TCGA 2 cut(s) 496, 668
TasI AATT 3 cut(s) 330, 380, 658
TauI GCSGC 1 cut(s) 423
TfiI GAWTC 1 cut(s) 553
TscAI CASTG 1 cut(s) 114
TseI GCWGC 9 cut(s) 28, 278, 281, 284, 287, 363, 366, 369, 423
TspDTI ATGAA 5 cut(s) 17, 249, 493, 525, 651
TspGWI ACGGA 2 cut(s) 21, 71
TspRI CASTG 1 cut(s) 114
VpaK11BI GGWCC 2 cut(s) 94, 609
XcmI CCANNNNNNNNNTGG 1 cut(s) 470
Zsp2I ATGCAT 1 cut(s) 510
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.