Rmu_sc0000517.1_g000003

Protein of unknown function (DUF962)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000517.1
Physical Location & Seq
Reverse (-)
16698 .. 17027
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000517.1_g000003.1.cds

Sequence Viewer

Length: 330 bp
atgaatttcaggagcttggatgagttctgggccttctacatgagccaacactcgaaaccatcgacaaggcgtttgcattttgtggggacccttattagtatcatcttcctcataatctcggctctgttcaattggtggcttctgatctttgtgcctctctctgggtatggatttgcttggtacagccatttctttgtcgaagggaatattccggcgacgtttgggcatccgttttggtctctgttatgtgattacaagatgtttggattgatgcttactgggaatatggacaaagagatcaagaggcttggaaagaggcctgtgttctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.9

Weight (kDa)

9.52

Isoelectric Point (pI)

46.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016709)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G09085
malus_domestica MD04G1146800.v1.1
prunus_persica Prupe.6G270600_v2.0.a1
pyrus_communis pycom04g13260 pycom12g15190
rosa_chinensis RchiOBHm_Chr3g0463891
rosa_laevigata RLG00000024738
rosa_multiflora Rmu_sc0000517.1_g000003
rosa_roxburghii Rroxscaffold_6G00416160
rosa_rugosa Rorug03G0069000
rosa_samantha Rh3BG130000 Rh3CG132500 Rh3DG131200
rosa_wichuraiana Rw3G010630

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 4
AfaI GTAC 1 cut(s) 182
AfiI CCNNNNNNNGG 1 cut(s) 161
AgsI TTSAA 1 cut(s) 130
AluBI AGCT 1 cut(s) 15
AluI AGCT 1 cut(s) 15
Alw26I GTCTC 1 cut(s) 243
AoxI GGCC 2 cut(s) 30, 317
ApoI RAATTY 1 cut(s) 4
ArsI GACNNNNNNTTYG 2 cut(s) 55, 87
AspS9I GGNCC 2 cut(s) 30, 87
AvaII GGWCC 1 cut(s) 87
BccI CCATC 1 cut(s) 67
BcoDI GTCTC 1 cut(s) 243
Bme18I GGWCC 1 cut(s) 87
BmgT120I GGNCC 2 cut(s) 30, 87
BmiI GGNNCC 2 cut(s) 88, 89
BmrI ACTGGG 1 cut(s) 288
BmsI GCATC 2 cut(s) 235, 261
BmuI ACTGGG 1 cut(s) 288
BsaI GGTCTC 1 cut(s) 243
Bsc4I CCNNNNNNNGG 1 cut(s) 161
Bse1I ACTGG 1 cut(s) 283
BseGI GGATG 2 cut(s) 25, 226
BseLI CCNNNNNNNGG 1 cut(s) 161
BseNI ACTGG 1 cut(s) 283
BshFI GGCC 2 cut(s) 32, 319
BsiSI CCGG 1 cut(s) 212
BslFI GGGAC 1 cut(s) 100
BslI CCNNNNNNNGG 1 cut(s) 161
BsmAI GTCTC 1 cut(s) 243
BsmFI GGGAC 1 cut(s) 100
BsnI GGCC 2 cut(s) 32, 319
Bso31I GGTCTC 1 cut(s) 243
Bsp143I GATC 2 cut(s) 144, 297
BspANI GGCC 2 cut(s) 32, 319
BspLI GGNNCC 2 cut(s) 88, 89
BspTNI GGTCTC 1 cut(s) 243
BsrI ACTGG 1 cut(s) 283
BssMI GATC 2 cut(s) 144, 297
BstF5I GGATG 2 cut(s) 25, 226
BstKTI GATC 2 cut(s) 147, 300
BstMAI GTCTC 1 cut(s) 243
BstMBI GATC 2 cut(s) 144, 297
BsuRI GGCC 2 cut(s) 32, 319
BtsCI GGATG 2 cut(s) 25, 226
Cfr13I GGNCC 2 cut(s) 30, 87
Csp6I GTAC 1 cut(s) 181
CviAII CATG 1 cut(s) 40
CviJI RGCY 8 cut(s) 15, 32, 45, 122, 139, 186, 307, 319
CviKI_1 RGCY 8 cut(s) 15, 32, 45, 122, 139, 186, 307, 319
CviQI GTAC 1 cut(s) 181
DpnI GATC 2 cut(s) 146, 299
DpnII GATC 2 cut(s) 144, 297
Eco147I AGGCCT 1 cut(s) 319
Eco31I GGTCTC 1 cut(s) 243
Eco47I GGWCC 1 cut(s) 87
EcoO109I RGGNCCY 1 cut(s) 87
FaeI CATG 1 cut(s) 43
FaiI YATR 5 cut(s) 41, 113, 168, 247, 287
FaqI GGGAC 1 cut(s) 100
FatI CATG 1 cut(s) 39
FokI GGATG 2 cut(s) 32, 213
HaeIII GGCC 2 cut(s) 32, 319
HapII CCGG 1 cut(s) 212
Hin1II CATG 1 cut(s) 43
HpaII CCGG 1 cut(s) 212
Hpy188I TCNGA 1 cut(s) 144
Hpy188III TCNNGA 2 cut(s) 10, 301
Hpy99I CGWCG 1 cut(s) 220
HpyAV CCTTC 2 cut(s) 43, 194
HpyCH4IV ACGT 1 cut(s) 218
HpyCH4V TGCA 1 cut(s) 76
HpySE526I ACGT 1 cut(s) 218
Hsp92II CATG 1 cut(s) 43
KflI GGGWCCC 1 cut(s) 87
Kzo9I GATC 2 cut(s) 144, 297
LmnI GCTCC 1 cut(s) 12
LpnPI CCDG 4 cut(s) 13, 147, 225, 264
LweI GCATC 2 cut(s) 235, 261
MaeII ACGT 1 cut(s) 218
MalI GATC 2 cut(s) 146, 299
MboI GATC 2 cut(s) 144, 297
MboII GAAGA 1 cut(s) 97
MfeI CAATTG 1 cut(s) 130
MluCI AATT 2 cut(s) 4, 130
MnlI CCTC 4 cut(s) 119, 165, 297, 309
MspI CCGG 1 cut(s) 212
MunI CAATTG 1 cut(s) 130
NdeII GATC 2 cut(s) 144, 297
NlaIII CATG 1 cut(s) 43
NlaIV GGNNCC 2 cut(s) 88, 89
NmeAIII GCCGAG 1 cut(s) 98
PceI AGGCCT 1 cut(s) 319
PcsI WCGNNNNNNNCGW 1 cut(s) 59
PpuMI RGGWCCY 1 cut(s) 87
Psp5II RGGWCCY 1 cut(s) 87
PspN4I GGNNCC 2 cut(s) 88, 89
PspPI GGNCC 2 cut(s) 30, 87
PspPPI RGGWCCY 1 cut(s) 87
RsaI GTAC 1 cut(s) 182
RsaNI GTAC 1 cut(s) 181
Sau3AI GATC 2 cut(s) 144, 297
Sau96I GGNCC 2 cut(s) 30, 87
SetI ASST 2 cut(s) 17, 221
SfaNI GCATC 2 cut(s) 235, 261
SinI GGWCC 1 cut(s) 87
Sse9I AATT 2 cut(s) 4, 130
SseBI AGGCCT 1 cut(s) 319
SspI AATATT 1 cut(s) 208
StuI AGGCCT 1 cut(s) 319
TaiI ACGT 1 cut(s) 221
TaqI TCGA 3 cut(s) 53, 62, 198
TasI AATT 2 cut(s) 4, 130
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 219
VpaK11BI GGWCC 1 cut(s) 87
XapI RAATTY 1 cut(s) 4
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.