Rmu_sc0000655.1_g000019

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000655.1
Physical Location & Seq
Reverse (-)
134880 .. 135327
448 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000655.1_g000019.1.cds

Sequence Viewer

Length: 309 bp
atggcagaacttatatctggaaaggttacacagcaaccaaatgacaaacctgcatcgcgctttaagattttgttcaatctgtacaacctactggaggacccatgtagtcggttctctgtttacttgagcgctctaaatttggccatcaatggaaaggtcactgagcatgtcctcccttcattcaaacagatagatagttccttgaaggagtggaatattggggtcttggaccagaggcagctatttcttaccatatctaatgttttaaaagaacgtaaaaggtatcctatgcgtagccctttcctatga

Protein Analysis

102

Amino Acids

11.77

Weight (kDa)

9.61

Isoelectric Point (pI)

38.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019880)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0165331 RchiOBHm_Chr2g0165451
rosa_laevigata RLG00000021526
rosa_multiflora Rmu_sc0000655.1_g000019
rosa_samantha Rh2BG594100
rosa_wichuraiana Rw2G048440 Rw2G048490

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 58
AccII CGCG 1 cut(s) 58
AcoI YGGCCR 1 cut(s) 141
AcsI RAATTY 1 cut(s) 136
AfaI GTAC 1 cut(s) 83
AfeI AGCGCT 1 cut(s) 130
AfiI CCNNNNNNNGG 1 cut(s) 94
AgsI TTSAA 3 cut(s) 76, 184, 205
AluBI AGCT 1 cut(s) 241
AluI AGCT 1 cut(s) 241
Aor51HI AGCGCT 1 cut(s) 130
AoxI GGCC 1 cut(s) 141
ApeKI GCWGC 1 cut(s) 238
ApoI RAATTY 1 cut(s) 136
AspLEI GCGC 2 cut(s) 60, 131
AspS9I GGNCC 2 cut(s) 97, 229
AvaII GGWCC 2 cut(s) 97, 229
BalI TGGCCA 1 cut(s) 143
BbvI GCAGC 1 cut(s) 250
BccI CCATC 1 cut(s) 152
BciVI GTATCC 1 cut(s) 294
BfoI RGCGCY 1 cut(s) 132
BfuAI ACCTGC 1 cut(s) 58
BfuI GTATCC 1 cut(s) 294
BisI GCNGC 1 cut(s) 239
BlsI GCNGC 1 cut(s) 240
Bme18I GGWCC 2 cut(s) 97, 229
BmgT120I GGNCC 2 cut(s) 97, 229
BmiI GGNNCC 1 cut(s) 99
BmsI GCATC 1 cut(s) 62
BpmI CTGGAG 1 cut(s) 113
BpuEI CTTGAG 1 cut(s) 145
Bsc4I CCNNNNNNNGG 1 cut(s) 94
Bse1I ACTGG 1 cut(s) 96
BseLI CCNNNNNNNGG 1 cut(s) 94
BseMII CTCAG 1 cut(s) 153
BseNI ACTGG 1 cut(s) 96
BseXI GCAGC 1 cut(s) 250
Bsh1236I CGCG 1 cut(s) 58
BshFI GGCC 1 cut(s) 143
BslI CCNNNNNNNGG 1 cut(s) 94
BsnI GGCC 1 cut(s) 143
Bsp1407I TGTACA 1 cut(s) 81
BspANI GGCC 1 cut(s) 143
BspCNI CTCAG 1 cut(s) 154
BspFNI CGCG 1 cut(s) 58
BspLI GGNNCC 1 cut(s) 99
BspMI ACCTGC 1 cut(s) 58
BsrGI TGTACA 1 cut(s) 81
BsrI ACTGG 1 cut(s) 96
BstAUI TGTACA 1 cut(s) 81
BstDEI CTNAG 1 cut(s) 162
BstENI CCTNNNNNAGG 1 cut(s) 92
BstFNI CGCG 1 cut(s) 58
BstH2I RGCGCY 1 cut(s) 132
BstHHI GCGC 2 cut(s) 60, 131
BstNSI RCATGY 1 cut(s) 170
BstUI CGCG 1 cut(s) 58
BstV1I GCAGC 1 cut(s) 250
BsuI GTATCC 1 cut(s) 294
BsuRI GGCC 1 cut(s) 143
BtgZI GCGATG 1 cut(s) 39
BtsIMutI CAGTG 1 cut(s) 159
BveI ACCTGC 1 cut(s) 58
CfoI GCGC 2 cut(s) 60, 131
Cfr13I GGNCC 2 cut(s) 97, 229
Csp6I GTAC 1 cut(s) 82
CviAII CATG 2 cut(s) 102, 167
CviJI RGCY 3 cut(s) 143, 241, 297
CviKI_1 RGCY 3 cut(s) 143, 241, 297
CviQI GTAC 1 cut(s) 82
DdeI CTNAG 1 cut(s) 162
DraI TTTAAA 1 cut(s) 267
EaeI YGGCCR 1 cut(s) 141
Eco47I GGWCC 2 cut(s) 97, 229
Eco47III AGCGCT 1 cut(s) 130
EcoNI CCTNNNNNAGG 1 cut(s) 92
EcoO109I RGGNCCY 1 cut(s) 97
FaeI CATG 2 cut(s) 105, 170
FaiI YATR 6 cut(s) 14, 103, 168, 254, 290, 307
FatI CATG 2 cut(s) 101, 166
Fnu4HI GCNGC 1 cut(s) 239
Fsp4HI GCNGC 1 cut(s) 239
GlaI GCGC 2 cut(s) 59, 130
GluI GCNGC 1 cut(s) 239
GsuI CTGGAG 1 cut(s) 113
HaeII RGCGCY 1 cut(s) 132
HaeIII GGCC 1 cut(s) 143
HhaI GCGC 2 cut(s) 60, 131
Hin1II CATG 2 cut(s) 105, 170
Hin6I GCGC 2 cut(s) 58, 129
HinP1I GCGC 2 cut(s) 58, 129
Hpy166II GTNNAC 1 cut(s) 121
Hpy188III TCNNGA 1 cut(s) 18
Hpy8I GTNNAC 1 cut(s) 121
HpyAV CCTTC 2 cut(s) 186, 199
HpyCH4IV ACGT 1 cut(s) 274
HpyCH4V TGCA 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 162
HpySE526I ACGT 1 cut(s) 274
Hsp92II CATG 2 cut(s) 105, 170
HspAI GCGC 2 cut(s) 58, 129
LpnPI CCDG 4 cut(s) 3, 63, 77, 245
Lsp1109I GCAGC 1 cut(s) 250
LweI GCATC 1 cut(s) 62
MaeII ACGT 1 cut(s) 274
MaeIII GTNAC 2 cut(s) 25, 157
MlsI TGGCCA 1 cut(s) 143
MluCI AATT 1 cut(s) 136
MluNI TGGCCA 1 cut(s) 143
MnlI CCTC 3 cut(s) 88, 182, 228
Mox20I TGGCCA 1 cut(s) 143
MscI TGGCCA 1 cut(s) 143
MseI TTAA 2 cut(s) 63, 266
Msp20I TGGCCA 1 cut(s) 143
MvnI CGCG 1 cut(s) 58
NlaIII CATG 2 cut(s) 105, 170
NlaIV GGNNCC 1 cut(s) 99
NmuCI GTSAC 1 cut(s) 157
NspI RCATGY 1 cut(s) 170
PkrI GCNGC 1 cut(s) 240
PpuMI RGGWCCY 1 cut(s) 97
Psp5II RGGWCCY 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 99
PspPI GGNCC 2 cut(s) 97, 229
PspPPI RGGWCCY 1 cut(s) 97
RsaI GTAC 1 cut(s) 83
RsaNI GTAC 1 cut(s) 82
SaqAI TTAA 2 cut(s) 63, 266
SatI GCNGC 1 cut(s) 239
Sau96I GGNCC 2 cut(s) 97, 229
SetI ASST 7 cut(s) 27, 52, 90, 159, 243, 277, 284
SfaNI GCATC 1 cut(s) 62
SinI GGWCC 2 cut(s) 97, 229
SmlI CTYRAG 1 cut(s) 124
SmoI CTYRAG 1 cut(s) 124
Sse9I AATT 1 cut(s) 136
SspI AATATT 1 cut(s) 217
TaiI ACGT 1 cut(s) 277
TasI AATT 1 cut(s) 136
TatI WGTACW 1 cut(s) 81
Tru1I TTAA 2 cut(s) 63, 266
Tru9I TTAA 2 cut(s) 63, 266
TscAI CASTG 1 cut(s) 166
TseFI GTSAC 1 cut(s) 157
TseI GCWGC 1 cut(s) 238
Tsp45I GTSAC 1 cut(s) 157
TspDTI ATGAA 1 cut(s) 168
TspRI CASTG 1 cut(s) 166
VpaK11BI GGWCC 2 cut(s) 97, 229
XagI CCTNNNNNAGG 1 cut(s) 92
XapI RAATTY 1 cut(s) 136
XceI RCATGY 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.