Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000908.1

Orthogroup ID

OG0019398

Physical Location & Seq

Genomic Coordinates Forward (+)

65054 .. 65962

Gene Structure 909 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000908.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 909 bp

atggtcctggcaggagtgaaaccaaatgcaataacatttatcagtctttttacaggttgtagccattctggattggtagaggaaggtttaaagtacttttactctgtagagaaaacatatggcatagtacctagagctggacattacttttgcgttattgatttacttggccgggctggaaggcttgaagaggccaaagaattcattaacagcatgccaatgcagccaaatgcttttgggtggtgctcttttcttggtgcttgcaagattcatggagataaagagaggggcaaactcgcagcggagaaattgatacagcttgaacctgagaatagtggagcacatgtttttctttcaactttacatgcaaaggagcaaaaatgggaagatttcagaagtgtgaggaagatgatgagagacagcagcatgaaaaaattgcctggttatagttgggttgatgttggaaacaaaacacacgtgtttggagccgaagattggtcccatcctcagaagaaagaaatatatgagacacttgatagtcttcttcatcagatcaagaaagctggatatgttccaaatacagatcttgttctacatgatatggacgacaattcaaaggtagagcttcttcaccatcatagtgggaggattgcaattgcattcgcattgataagtatgcctgcagccgggaagccaatcattgtgaagacaaatataagggtgtgcttggattgccattctgcaatcaagtacgtttccttggttgtgtctccttggttgttggaagaaagattattgttagggataatacttggtttcaccttttcgcagatgcgttgtgttcatgtggagattactggtcaaagttttgaaggccaaagttttgtaaaggaacgcatacaaaagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

302

Amino Acids

33.98

Weight (kDa)

8.38

Isoelectric Point (pI)

31.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019398)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0473261 RchiOBHm_Chr3g0473321
rosa_laevigata	RLG00000024008
rosa_multiflora	Rmu_sc0000908.1_g000015
rosa_roxburghii	Rroxscaffold_6G00408160
rosa_samantha	Rh3BG210600 Rh3BG210900 Rh3DG207800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	302
AcoI	YGGCCR	1 cut(s)	169
AcsI	RAATTY	1 cut(s)	200
AcvI	CACGTG	1 cut(s)	478
AfaI	GTAC	3 cut(s)	95, 129, 752
AfiI	CCNNNNNNNGG	3 cut(s)	137, 495, 686
AflIII	ACRYGT	3 cut(s)	343, 475, 477
AgsI	TTSAA	5 cut(s)	188, 323, 357, 615, 872
AjnI	CCWGG	2 cut(s)	6, 439
AluBI	AGCT	4 cut(s)	137, 319, 563, 625
AluI	AGCT	4 cut(s)	137, 319, 563, 625
Alw21I	GWGCWC	2 cut(s)	248, 343
Alw26I	GTCTC	3 cut(s)	411, 521, 774
AoxI	GGCC	3 cut(s)	169, 192, 874
ApeKI	GCWGC	4 cut(s)	223, 299, 423, 683
ApoI	RAATTY	1 cut(s)	200
ArsI	GACNNNNNNTTYG	2 cut(s)	132, 164
AspS9I	GGNCC	2 cut(s)	4, 498
AsuC2I	CCSGG	2 cut(s)	173, 688
AsuHPI	GGTGA	2 cut(s)	623, 811
AvaII	GGWCC	2 cut(s)	4, 498
BarI	GAAGNNNNNNTAC	2 cut(s)	612, 644
BbrPI	CACGTG	1 cut(s)	478
BbsI	GAAGAC	2 cut(s)	533, 713
Bbv12I	GWGCWC	2 cut(s)	248, 343
BbvI	GCAGC	4 cut(s)	235, 311, 435, 695
BccI	CCATC	2 cut(s)	510, 642
BciT130I	CCWGG	2 cut(s)	8, 441
BcnI	CCSGG	2 cut(s)	173, 688
BcoDI	GTCTC	3 cut(s)	411, 521, 774
BfaI	CTAG	1 cut(s)	132
BfmI	CTRYAG	2 cut(s)	105, 681
BglII	AGATCT	1 cut(s)	583
BisI	GCNGC	4 cut(s)	224, 300, 424, 684
BlsI	GCNGC	4 cut(s)	225, 301, 425, 685
BmcAI	AGTACT	1 cut(s)	95
Bme1390I	CCNGG	4 cut(s)	8, 173, 441, 688
Bme18I	GGWCC	2 cut(s)	4, 498
BmgT120I	GGNCC	2 cut(s)	4, 498
BmiI	GGNNCC	2 cut(s)	487, 500
BmrFI	CCNGG	4 cut(s)	8, 173, 441, 688
BmsI	GCATC	1 cut(s)	822
BpiI	GAAGAC	2 cut(s)	533, 713
BpuMI	CCSGG	2 cut(s)	173, 688
BsaAI	YACGTR	1 cut(s)	478
BsaJI	CCNNGG	2 cut(s)	759, 773
BsaXI	ACNNNNNCTCC	2 cut(s)	330, 360
Bsc4I	CCNNNNNNNGG	3 cut(s)	137, 495, 686
Bse1I	ACTGG	1 cut(s)	862
BseBI	CCWGG	2 cut(s)	8, 441
BseDI	CCNNGG	2 cut(s)	759, 773
BseGI	GGATG	1 cut(s)	502
BseLI	CCNNNNNNNGG	3 cut(s)	137, 495, 686
BseMII	CTCAG	2 cut(s)	318, 521
BseNI	ACTGG	1 cut(s)	862
BseXI	GCAGC	4 cut(s)	235, 311, 435, 695
BshFI	GGCC	3 cut(s)	171, 194, 876
BsiHKAI	GWGCWC	2 cut(s)	248, 343
BsiSI	CCGG	2 cut(s)	172, 687
BslFI	GGGAC	1 cut(s)	484
BslI	CCNNNNNNNGG	3 cut(s)	137, 495, 686
BsmAI	GTCTC	3 cut(s)	411, 521, 774
BsmFI	GGGAC	1 cut(s)	484
BsmI	GAATGC	1 cut(s)	659
BsnI	GGCC	3 cut(s)	171, 194, 876
Bsp1286I	GDGCHC	2 cut(s)	248, 343
Bsp143I	GATC	2 cut(s)	552, 583
BspACI	CCGC	1 cut(s)	302
BspANI	GGCC	3 cut(s)	171, 194, 876
BspCNI	CTCAG	2 cut(s)	319, 520
BspLI	GGNNCC	2 cut(s)	487, 500
BspMAI	CTGCAG	1 cut(s)	685
BsrI	ACTGG	1 cut(s)	862
BssECI	CCNNGG	2 cut(s)	759, 773
BssMI	GATC	2 cut(s)	552, 583
BssT1I	CCWWGG	2 cut(s)	759, 773
Bst2UI	CCWGG	2 cut(s)	8, 441
Bst6I	CTCTTC	1 cut(s)	183
BstBAI	YACGTR	1 cut(s)	478
BstC8I	GCNNGC	3 cut(s)	215, 262, 681
BstDEI	CTNAG	2 cut(s)	327, 507
BstF5I	GGATG	1 cut(s)	502
BstKTI	GATC	2 cut(s)	555, 586
BstMAI	GTCTC	3 cut(s)	411, 521, 774
BstMBI	GATC	2 cut(s)	552, 583
BstMWI	GCNNNNNNNGC	2 cut(s)	223, 732
BstNI	CCWGG	2 cut(s)	8, 441
BstNSI	RCATGY	3 cut(s)	217, 347, 368
BstSCI	CCNGG	4 cut(s)	6, 171, 439, 686
BstSFI	CTRYAG	2 cut(s)	105, 681
BstV1I	GCAGC	4 cut(s)	235, 311, 435, 695
BstV2I	GAAGAC	2 cut(s)	533, 713
BstX2I	RGATCY	1 cut(s)	583
BstXI	CCANNNNNNTGG	1 cut(s)	641
BstYI	RGATCY	1 cut(s)	583
BsuRI	GGCC	3 cut(s)	171, 194, 876
BtsCI	GGATG	1 cut(s)	502
Cac8I	GCNNGC	3 cut(s)	215, 262, 681
Cfr13I	GGNCC	2 cut(s)	4, 498
Csp6I	GTAC	3 cut(s)	94, 128, 751
CviAII	CATG	7 cut(s)	214, 272, 344, 365, 427, 596, 845
CviQI	GTAC	3 cut(s)	94, 128, 751
DdeI	CTNAG	2 cut(s)	327, 507
DpnI	GATC	2 cut(s)	554, 585
DpnII	GATC	2 cut(s)	552, 583
DraI	TTTAAA	1 cut(s)	90
EaeI	YGGCCR	1 cut(s)	169
Eam1104I	CTCTTC	1 cut(s)	183
EarI	CTCTTC	1 cut(s)	183
Eco130I	CCWWGG	2 cut(s)	759, 773
Eco47I	GGWCC	2 cut(s)	4, 498
Eco72I	CACGTG	1 cut(s)	478
EcoRI	GAATTC	1 cut(s)	200
EcoRII	CCWGG	2 cut(s)	6, 439
EcoT14I	CCWWGG	2 cut(s)	759, 773
ErhI	CCWWGG	2 cut(s)	759, 773
FaeI	CATG	7 cut(s)	217, 275, 347, 368, 430, 599, 848
FaqI	GGGAC	1 cut(s)	484
FatI	CATG	7 cut(s)	213, 271, 343, 364, 426, 595, 844
FauNDI	CATATG	1 cut(s)	118
Fnu4HI	GCNGC	4 cut(s)	224, 300, 424, 684
FokI	GGATG	1 cut(s)	489
Fsp4HI	GCNGC	4 cut(s)	224, 300, 424, 684
FspBI	CTAG	1 cut(s)	132
GluI	GCNGC	4 cut(s)	224, 300, 424, 684
HaeIII	GGCC	3 cut(s)	171, 194, 876
HapII	CCGG	2 cut(s)	172, 687
Hin1II	CATG	7 cut(s)	217, 275, 347, 368, 430, 599, 848
HinfI	GANTC	1 cut(s)	268
HpaII	CCGG	2 cut(s)	172, 687
HphI	GGTGA	2 cut(s)	623, 811
Hpy188I	TCNGA	3 cut(s)	395, 510, 552
Hpy188III	TCNNGA	2 cut(s)	69, 556
HpyAV	CCTTC	3 cut(s)	77, 174, 866
HpyCH4IV	ACGT	2 cut(s)	477, 753
HpyCH4V	TGCA	8 cut(s)	29, 223, 264, 368, 653, 659, 683, 743
HpyF10VI	GCNNNNNNNGC	2 cut(s)	223, 732
HpyF3I	CTNAG	2 cut(s)	327, 507
HpySE526I	ACGT	2 cut(s)	477, 753
Hsp92II	CATG	7 cut(s)	217, 275, 347, 368, 430, 599, 848
Kzo9I	GATC	2 cut(s)	552, 583
LmnI	GCTCC	3 cut(s)	338, 373, 485
Lsp1109I	GCAGC	4 cut(s)	235, 311, 435, 695
LweI	GCATC	1 cut(s)	822
MaeI	CTAG	1 cut(s)	132
MaeII	ACGT	2 cut(s)	477, 753
MalI	GATC	2 cut(s)	554, 585
MboI	GATC	2 cut(s)	552, 583
MfeI	CAATTG	1 cut(s)	654
MflI	RGATCY	1 cut(s)	583
MhlI	GDGCHC	2 cut(s)	248, 343
MluCI	AATT	5 cut(s)	200, 308, 434, 610, 654
MmeI	TCCRAC	2 cut(s)	442, 762
MnlI	CCTC	6 cut(s)	73, 184, 279, 396, 516, 639
MseI	TTAA	2 cut(s)	89, 207
MslI	CAYNNNNRTG	2 cut(s)	218, 639
MspA1I	CMGCKG	1 cut(s)	302
MspI	CCGG	2 cut(s)	172, 687
MspR9I	CCNGG	4 cut(s)	8, 173, 441, 688
MunI	CAATTG	1 cut(s)	654
Mva1269I	GAATGC	1 cut(s)	659
MvaI	CCWGG	2 cut(s)	8, 441
MwoI	GCNNNNNNNGC	2 cut(s)	223, 732
NciI	CCSGG	2 cut(s)	173, 688
NdeI	CATATG	1 cut(s)	118
NdeII	GATC	2 cut(s)	552, 583
NlaIII	CATG	7 cut(s)	217, 275, 347, 368, 430, 599, 848
NlaIV	GGNNCC	2 cut(s)	487, 500
NspI	RCATGY	3 cut(s)	217, 347, 368
PaeI	GCATGC	1 cut(s)	217
PciI	ACATGT	1 cut(s)	343
PctI	GAATGC	1 cut(s)	659
PfeI	GAWTC	1 cut(s)	268
PkrI	GCNGC	4 cut(s)	225, 301, 425, 685
PmaCI	CACGTG	1 cut(s)	478
PmlI	CACGTG	1 cut(s)	478
Ppu21I	YACGTR	1 cut(s)	478
PscI	ACATGT	1 cut(s)	343
Psp6I	CCWGG	2 cut(s)	6, 439
PspCI	CACGTG	1 cut(s)	478
PspGI	CCWGG	2 cut(s)	6, 439
PspN4I	GGNNCC	2 cut(s)	487, 500
PspPI	GGNCC	2 cut(s)	4, 498
PstI	CTGCAG	1 cut(s)	685
PsuI	RGATCY	1 cut(s)	583
RsaI	GTAC	3 cut(s)	95, 129, 752
RsaNI	GTAC	3 cut(s)	94, 128, 751
RseI	CAYNNNNRTG	2 cut(s)	218, 639
SaqAI	TTAA	2 cut(s)	89, 207
SatI	GCNGC	4 cut(s)	224, 300, 424, 684
Sau3AI	GATC	2 cut(s)	552, 583
Sau96I	GGNCC	2 cut(s)	4, 498
ScaI	AGTACT	1 cut(s)	95
ScrFI	CCNGG	4 cut(s)	8, 173, 441, 688
SduI	GDGCHC	2 cut(s)	248, 343
SfaNI	GCATC	1 cut(s)	822
SfcI	CTRYAG	2 cut(s)	105, 681
SinI	GGWCC	2 cut(s)	4, 498
SmiMI	CAYNNNNRTG	2 cut(s)	218, 639
SphI	GCATGC	1 cut(s)	217
Sse9I	AATT	5 cut(s)	200, 308, 434, 610, 654
SsiI	CCGC	1 cut(s)	302
SspMI	CTAG	1 cut(s)	132
StyD4I	CCNGG	4 cut(s)	6, 171, 439, 686
StyI	CCWWGG	2 cut(s)	759, 773
TaiI	ACGT	2 cut(s)	480, 756
TasI	AATT	5 cut(s)	200, 308, 434, 610, 654
TatI	WGTACW	1 cut(s)	93
TfiI	GAWTC	1 cut(s)	268
Tru1I	TTAA	2 cut(s)	89, 207
Tru9I	TTAA	2 cut(s)	89, 207
TseI	GCWGC	4 cut(s)	223, 299, 423, 683
TspDTI	ATGAA	5 cut(s)	193, 260, 443, 536, 833
VpaK11BI	GGWCC	2 cut(s)	4, 498
XapI	RAATTY	1 cut(s)	200
XceI	RCATGY	3 cut(s)	217, 347, 368
XspI	CTAG	1 cut(s)	132
ZrmI	AGTACT	1 cut(s)	95

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.