Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001181.1

Orthogroup ID

OG0004814

Physical Location & Seq

Genomic Coordinates Reverse (-)

17934 .. 21364

Gene Structure 3431 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001181.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1341 bp

atggcatctgatccaattccaggcatggagtcggtggtggcctccgtcagtgggtaccggggatcggagctggtgaatctgatcgagctcatgactcacaccggtgccagctacatcggtaccttgtcgccgtccaatgccttcactcatatggtgtgccggaaatttgagggaaagagatacgaagtggctaaaaagttgaaactcataattgttaaccaccggtggattgaggattgcgtaaagcatcgaaagcgagttcctgagcatccctataccttgcaaagtggacaggaagtgggacccttactgttgaaagttccacttgttgctgaaccaggcttctcggttaagaaggggaaagcggtttctgataaagctcatgtttttggcgactctgaagaaattatcgatctggggtgtggaccttctcgccgtggtgtttcgactgattcaagtctattgaatgagaatttgtttcctgactttcaagaaaacaatagttcccagaagcgacagaataaatctgtgaaaacaaattcaaagaaagagccacaatctagtagcagagactgttttgaagatcctcctttatccagatcactcagaatggaggagttttgcaggcattcagttagagctcaaagaaatattaccagtgacactggaaccagcatgactgaaattccacgtaaaaaaaggaggcttgtgaaaaagaatattggctctacaatatcagtactctcagaatctgatcgagaatgccacccaatcagatttcacagcatccgtaatgacagggtcacaatcctttctgatgattctaatgacgagttagacactggaacaggaatcagagatgtgggacgtaaaggtgttgatgtcggtggtaatcacttatctacttccaaggatcccaatttttctgttgtggatgagcctacagctcctgagggaactccacaaaatgggtgccctgaagtagataattcaaaagaggaattggaaatcaagttggacacagagcatgccaccaaaagtccttcacaggaattatcgtgtgttatatgctggacagagtttagtacaacccgaggaattttgccatgtggtcatcgatactgttattcttgtattgaaaattgggctgatcaactgggttcaaggagaaagatttcaacatgccctttatgcaaagcttcatttacagtcattaccaaggttgatgatgcagtcactagtgatcaaaatatattttctcaaaccattccatctgccccaaaagtggacatttcatttcttaatgaccagggaacatctaattttgctgctcaggtatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00480 ko00590 ko04918 map00480 map00590 map04918

Pfam Domains

Protein Families

PTCB-BRCT zf-C3HC4 zf-RING_2

Protein Analysis

446

Amino Acids

49.35

Weight (kDa)

6.86

Isoelectric Point (pI)

44.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004814)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G67180 AT1G67180 AT1G67180 AT1G67180 AT1G67180 AT1G67180 AT1G67180
fragaria_vesca	FvH4_6g45660 FvH4_6g45660 FvH4_6g45660 FvH4_6g45660 FvH4_6g45660 FvH4_6g45660 FvH4_6g45660
malus_domestica	MD17G1072100.v1.1
prunus_persica	Prupe.3G242700_v2.0.a1 Prupe.3G242700_v2.0.a1 Prupe.3G242700_v2.0.a1 Prupe.3G242700_v2.0.a1 Prupe.3G242700_v2.0.a1
pyrus_communis	pycom17g07140
rosa_chinensis	RchiOBHm_Chr2g0163811
rosa_laevigata	RLG00000021417
rosa_multiflora	Rmu_sc0001181.1_g000003
rosa_roxburghii	Rroxscaffold_2G00087000
rosa_rugosa	Rorug02G0504700
rosa_samantha	Rh2AG572600 Rh2BG583300 Rh2CG554200 Rh2DG592900
rosa_wichuraiana	Rw2G047340

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	2 cut(s)	54, 119
AccB1I	GGYRCC	4 cut(s)	54, 104, 119, 972
AccB7I	CCANNNNNTGG	1 cut(s)	968
AciI	CCGC	1 cut(s)	365
AclWI	GGATC	5 cut(s)	5, 70, 578, 908, 921
AcsI	RAATTY	5 cut(s)	164, 472, 538, 684, 1098
AcuI	CTGAAG	2 cut(s)	420, 999
AfaI	GTAC	4 cut(s)	56, 121, 741, 1087
AfiI	CCNNNNNNNGG	5 cut(s)	20, 51, 64, 968, 1285
AgeI	ACCGGT	2 cut(s)	101, 222
AhlI	ACTAGT	1 cut(s)	1238
AjnI	CCWGG	3 cut(s)	19, 337, 1308
AleI	CACNNNNGTG	1 cut(s)	102
AluBI	AGCT	7 cut(s)	70, 88, 111, 380, 641, 947, 1199
AluI	AGCT	7 cut(s)	70, 88, 111, 380, 641, 947, 1199
Alw21I	GWGCWC	2 cut(s)	90, 643
Alw26I	GTCTC	1 cut(s)	564
AlwI	GGATC	5 cut(s)	5, 70, 578, 908, 921
AlwNI	CAGNNNCTG	3 cut(s)	573, 752, 950
Ama87I	CYCGRG	1 cut(s)	1092
AoxI	GGCC	1 cut(s)	39
ApeKI	GCWGC	1 cut(s)	1328
ApoI	RAATTY	5 cut(s)	164, 472, 538, 684, 1098
AsiGI	ACCGGT	2 cut(s)	101, 222
Asp700I	GAANNNNTTC	1 cut(s)	1174
Asp718I	GGTACC	2 cut(s)	54, 119
AspS9I	GGNCC	2 cut(s)	302, 425
AsuC2I	CCSGG	1 cut(s)	59
AsuHPI	GGTGA	1 cut(s)	85
AvaI	CYCGRG	1 cut(s)	1092
AvaII	GGWCC	2 cut(s)	302, 425
AxyI	CCTNAGG	1 cut(s)	951
BaeGI	GKGCMC	1 cut(s)	977
BaeI	ACNNNNGTAYC	2 cut(s)	103, 136
BamHI	GGATCC	1 cut(s)	913
BanI	GGYRCC	4 cut(s)	54, 104, 119, 972
BanII	GRGCYC	2 cut(s)	90, 643
Bbv12I	GWGCWC	2 cut(s)	90, 643
BbvI	GCAGC	1 cut(s)	1315
BccI	CCATC	1 cut(s)	1279
BceAI	ACGGC	2 cut(s)	115, 420
BciT130I	CCWGG	3 cut(s)	21, 339, 1310
BclI	TGATCA	2 cut(s)	1150, 1243
BcnI	CCSGG	1 cut(s)	59
BcoDI	GTCTC	1 cut(s)	564
BcuI	ACTAGT	1 cut(s)	1238
BfaI	CTAG	2 cut(s)	561, 1239
BfmI	CTRYAG	1 cut(s)	942
BisI	GCNGC	1 cut(s)	1329
BlsI	GCNGC	1 cut(s)	1330
BmcAI	AGTACT	1 cut(s)	741
Bme1390I	CCNGG	4 cut(s)	21, 59, 339, 1310
Bme18I	GGWCC	2 cut(s)	302, 425
BmeT110I	CYCGRG	1 cut(s)	1092
BmgT120I	GGNCC	2 cut(s)	302, 425
BmiI	GGNNCC	8 cut(s)	56, 106, 121, 303, 304, 670, 915, 974
BmrFI	CCNGG	4 cut(s)	21, 59, 339, 1310
BmrI	ACTGGG	1 cut(s)	1166
BmsI	GCATC	5 cut(s)	14, 256, 277, 795, 1219
BmuI	ACTGGG	1 cut(s)	1166
Bpu10I	CCTNAGC	2 cut(s)	264, 1332
BpuMI	CCSGG	1 cut(s)	59
Bsa29I	ATCGAT	2 cut(s)	411, 1117
BsaAI	YACGTR	1 cut(s)	692
BsaJI	CCNNGG	6 cut(s)	58, 436, 909, 1093, 1218, 1309
BsaWI	WCCGGW	2 cut(s)	101, 222
Bsc4I	CCNNNNNNNGG	5 cut(s)	20, 51, 64, 968, 1285
Bse118I	RCCGGY	2 cut(s)	101, 222
Bse1I	ACTGG	4 cut(s)	657, 670, 847, 1161
Bse21I	CCTNAGG	1 cut(s)	951
BseBI	CCWGG	3 cut(s)	21, 339, 1310
BseCI	ATCGAT	2 cut(s)	411, 1117
BseDI	CCNNGG	6 cut(s)	58, 436, 909, 1093, 1218, 1309
BseGI	GGATG	3 cut(s)	268, 786, 940
BseLI	CCNNNNNNNGG	5 cut(s)	20, 51, 64, 968, 1285
BseMII	CTCAG	4 cut(s)	255, 619, 759, 942
BseNI	ACTGG	4 cut(s)	657, 670, 847, 1161
BseRI	GAGGAG	1 cut(s)	629
BseSI	GKGCMC	1 cut(s)	977
BseXI	GCAGC	1 cut(s)	1315
BshFI	GGCC	1 cut(s)	41
BshNI	GGYRCC	4 cut(s)	54, 104, 119, 972
BshTI	ACCGGT	2 cut(s)	101, 222
BshVI	ATCGAT	2 cut(s)	411, 1117
BsiHKAI	GWGCWC	2 cut(s)	90, 643
BsiHKCI	CYCGRG	1 cut(s)	1092
BsiSI	CCGG	4 cut(s)	58, 102, 160, 223
BslFI	GGGAC	2 cut(s)	315, 879
BslI	CCNNNNNNNGG	5 cut(s)	20, 51, 64, 968, 1285
BsmAI	GTCTC	1 cut(s)	564
BsmFI	GGGAC	2 cut(s)	315, 879
BsmI	GAATGC	2 cut(s)	628, 767
BsnI	GGCC	1 cut(s)	41
BsoBI	CYCGRG	1 cut(s)	1092
Bsp1286I	GDGCHC	3 cut(s)	90, 643, 977
BspACI	CCGC	1 cut(s)	365
BspANI	GGCC	1 cut(s)	41
BspCNI	CTCAG	4 cut(s)	256, 618, 758, 943
BspDI	ATCGAT	2 cut(s)	411, 1117
BspHI	TCATGA	1 cut(s)	90
BspLI	GGNNCC	8 cut(s)	56, 106, 121, 303, 304, 670, 915, 974
BspPI	GGATC	5 cut(s)	5, 70, 578, 908, 921
BspT107I	GGYRCC	4 cut(s)	54, 104, 119, 972
BsrFI	RCCGGY	2 cut(s)	101, 222
BsrI	ACTGG	4 cut(s)	657, 670, 847, 1161
BssAI	RCCGGY	2 cut(s)	101, 222
BssECI	CCNNGG	6 cut(s)	58, 436, 909, 1093, 1218, 1309
BssT1I	CCWWGG	2 cut(s)	909, 1218
Bst2UI	CCWGG	3 cut(s)	21, 339, 1310
Bst4CI	ACNGT	4 cut(s)	312, 575, 1124, 1210
BstBAI	YACGTR	1 cut(s)	692
BstC8I	GCNNGC	3 cut(s)	109, 626, 1029
BstDEI	CTNAG	5 cut(s)	264, 605, 745, 951, 1332
BstDSI	CCRYGG	1 cut(s)	436
BstF5I	GGATG	3 cut(s)	268, 786, 940
BstMAI	GTCTC	1 cut(s)	564
BstMWI	GCNNNNNNNGC	2 cut(s)	253, 1191
BstNI	CCWGG	3 cut(s)	21, 339, 1310
BstNSI	RCATGY	2 cut(s)	1031, 1185
BstSCI	CCNGG	4 cut(s)	19, 57, 337, 1308
BstSFI	CTRYAG	1 cut(s)	942
BstSLI	GKGCMC	1 cut(s)	977
BstV1I	GCAGC	1 cut(s)	1315
BstX2I	RGATCY	2 cut(s)	583, 913
BstYI	RGATCY	2 cut(s)	583, 913
Bsu15I	ATCGAT	2 cut(s)	411, 1117
Bsu36I	CCTNAGG	1 cut(s)	951
BsuRI	GGCC	1 cut(s)	41
BsuTUI	ATCGAT	2 cut(s)	411, 1117
BtgI	CCRYGG	1 cut(s)	436
BtsCI	GGATG	3 cut(s)	268, 786, 940
BtsIMutI	CAGTG	4 cut(s)	55, 663, 664, 840
Cac8I	GCNNGC	3 cut(s)	109, 626, 1029
CaiI	CAGNNNCTG	3 cut(s)	573, 752, 950
CciI	TCATGA	1 cut(s)	90
Cfr10I	RCCGGY	2 cut(s)	101, 222
Cfr13I	GGNCC	2 cut(s)	302, 425
ClaI	ATCGAT	2 cut(s)	411, 1117
Csp6I	GTAC	4 cut(s)	55, 120, 740, 1086
CspAI	ACCGGT	2 cut(s)	101, 222
CviAII	CATG	7 cut(s)	25, 91, 383, 676, 1028, 1107, 1182
CviQI	GTAC	4 cut(s)	55, 120, 740, 1086
DdeI	CTNAG	5 cut(s)	264, 605, 745, 951, 1332
Ecl136II	GAGCTC	2 cut(s)	88, 641
Eco130I	CCWWGG	2 cut(s)	909, 1218
Eco24I	GRGCYC	2 cut(s)	90, 643
Eco47I	GGWCC	2 cut(s)	302, 425
Eco53kI	GAGCTC	2 cut(s)	88, 641
Eco57I	CTGAAG	2 cut(s)	420, 999
Eco81I	CCTNAGG	1 cut(s)	951
Eco88I	CYCGRG	1 cut(s)	1092
EcoICRI	GAGCTC	2 cut(s)	88, 641
EcoO109I	RGGNCCY	1 cut(s)	302
EcoRII	CCWGG	3 cut(s)	19, 337, 1308
EcoT14I	CCWWGG	2 cut(s)	909, 1218
EcoT38I	GRGCYC	2 cut(s)	90, 643
ErhI	CCWWGG	2 cut(s)	909, 1218
FaeI	CATG	7 cut(s)	28, 94, 386, 679, 1031, 1110, 1185
FalI	AAGNNNNNCTT	2 cut(s)	309, 341
FaqI	GGGAC	2 cut(s)	315, 879
FatI	CATG	7 cut(s)	24, 90, 382, 675, 1027, 1106, 1181
FauNDI	CATATG	1 cut(s)	150
FbaI	TGATCA	2 cut(s)	1150, 1243
Fnu4HI	GCNGC	1 cut(s)	1329
FokI	GGATG	3 cut(s)	255, 773, 947
FriOI	GRGCYC	2 cut(s)	90, 643
Fsp4HI	GCNGC	1 cut(s)	1329
FspBI	CTAG	2 cut(s)	561, 1239
GluI	GCNGC	1 cut(s)	1329
HaeIII	GGCC	1 cut(s)	41
HapII	CCGG	4 cut(s)	58, 102, 160, 223
Hin1II	CATG	7 cut(s)	28, 94, 386, 679, 1031, 1110, 1185
HincII	GTYRAC	1 cut(s)	217
HindII	GTYRAC	1 cut(s)	217
HindIII	AAGCTT	1 cut(s)	1197
HinfI	GANTC	8 cut(s)	29, 76, 94, 395, 452, 749, 821, 852
HpaI	GTTAAC	1 cut(s)	217
HpaII	CCGG	4 cut(s)	58, 102, 160, 223
HphI	GGTGA	1 cut(s)	85
Hpy166II	GTNNAC	4 cut(s)	217, 290, 425, 1288
Hpy188III	TCNNGA	7 cut(s)	91, 263, 482, 491, 597, 758, 950
Hpy8I	GTNNAC	4 cut(s)	217, 290, 425, 1288
HpyAV	CCTTC	4 cut(s)	151, 349, 438, 1053
HpyCH4III	ACNGT	4 cut(s)	312, 575, 1124, 1210
HpyCH4IV	ACGT	2 cut(s)	691, 868
HpyCH4V	TGCA	4 cut(s)	283, 624, 1194, 1232
HpyF10VI	GCNNNNNNNGC	2 cut(s)	253, 1191
HpyF3I	CTNAG	5 cut(s)	264, 605, 745, 951, 1332
HpySE526I	ACGT	2 cut(s)	691, 868
Hsp92II	CATG	7 cut(s)	28, 94, 386, 679, 1031, 1110, 1185
KflI	GGGWCCC	1 cut(s)	302
KpnI	GGTACC	2 cut(s)	58, 123
Ksp22I	TGATCA	2 cut(s)	1150, 1243
KspAI	GTTAAC	1 cut(s)	217
LmnI	GCTCC	2 cut(s)	67, 952
Lsp1109I	GCAGC	1 cut(s)	1315
LweI	GCATC	5 cut(s)	14, 256, 277, 795, 1219
MaeI	CTAG	2 cut(s)	561, 1239
MaeII	ACGT	2 cut(s)	691, 868
MaeIII	GTNAC	3 cut(s)	659, 802, 1234
MboII	GAAGA	2 cut(s)	413, 593
MflI	RGATCY	2 cut(s)	583, 913
MhlI	GDGCHC	3 cut(s)	90, 643, 977
MlyI	GAGTC	3 cut(s)	38, 88, 389
MmeI	TCCRAC	1 cut(s)	996
MnlI	CCTC	9 cut(s)	52, 163, 226, 597, 607, 696, 946, 991, 1088
MroXI	GAANNNNTTC	1 cut(s)	1174
MseI	TTAA	3 cut(s)	216, 351, 1302
MslI	CAYNNNNRTG	2 cut(s)	102, 149
MspI	CCGG	4 cut(s)	58, 102, 160, 223
MspR9I	CCNGG	4 cut(s)	21, 59, 339, 1310
Mva1269I	GAATGC	2 cut(s)	628, 767
MvaI	CCWGG	3 cut(s)	21, 339, 1310
MwoI	GCNNNNNNNGC	2 cut(s)	253, 1191
NciI	CCSGG	1 cut(s)	59
NdeI	CATATG	1 cut(s)	150
NlaIII	CATG	7 cut(s)	28, 94, 386, 679, 1031, 1110, 1185
NlaIV	GGNNCC	8 cut(s)	56, 106, 121, 303, 304, 670, 915, 974
NmuCI	GTSAC	3 cut(s)	659, 802, 1234
NspI	RCATGY	2 cut(s)	1031, 1185
OliI	CACNNNNGTG	1 cut(s)	102
PaeI	GCATGC	1 cut(s)	1031
PagI	TCATGA	1 cut(s)	90
PctI	GAATGC	2 cut(s)	628, 767
PdmI	GAANNNNTTC	1 cut(s)	1174
PfeI	GAWTC	5 cut(s)	76, 452, 749, 821, 852
PflFI	GACNNNGTC	1 cut(s)	800
PflMI	CCANNNNNTGG	1 cut(s)	968
PinAI	ACCGGT	2 cut(s)	101, 222
PkrI	GCNGC	1 cut(s)	1330
PleI	GAGTC	3 cut(s)	37, 88, 389
PpsI	GAGTC	3 cut(s)	37, 88, 389
Ppu21I	YACGTR	1 cut(s)	692
PpuMI	RGGWCCY	1 cut(s)	302
Psp124BI	GAGCTC	2 cut(s)	90, 643
Psp5II	RGGWCCY	1 cut(s)	302
Psp6I	CCWGG	3 cut(s)	19, 337, 1308
PspGI	CCWGG	3 cut(s)	19, 337, 1308
PspN4I	GGNNCC	8 cut(s)	56, 106, 121, 303, 304, 670, 915, 974
PspPI	GGNCC	2 cut(s)	302, 425
PspPPI	RGGWCCY	1 cut(s)	302
PstNI	CAGNNNCTG	3 cut(s)	573, 752, 950
PsuI	RGATCY	2 cut(s)	583, 913
PsyI	GACNNNGTC	1 cut(s)	800
RsaI	GTAC	4 cut(s)	56, 121, 741, 1087
RsaNI	GTAC	4 cut(s)	55, 120, 740, 1086
RseI	CAYNNNNRTG	2 cut(s)	102, 149
SacI	GAGCTC	2 cut(s)	90, 643
SaqAI	TTAA	3 cut(s)	216, 351, 1302
SatI	GCNGC	1 cut(s)	1329
Sau96I	GGNCC	2 cut(s)	302, 425
ScaI	AGTACT	1 cut(s)	741
SchI	GAGTC	3 cut(s)	38, 88, 389
ScrFI	CCNGG	4 cut(s)	21, 59, 339, 1310
SduI	GDGCHC	3 cut(s)	90, 643, 977
SfaNI	GCATC	5 cut(s)	14, 256, 277, 795, 1219
SfcI	CTRYAG	1 cut(s)	942
SgrAI	CRCCGGYG	2 cut(s)	101, 222
SinI	GGWCC	2 cut(s)	302, 425
SmiMI	CAYNNNNRTG	2 cut(s)	102, 149
SpeI	ACTAGT	1 cut(s)	1238
SphI	GCATGC	1 cut(s)	1031
SsiI	CCGC	1 cut(s)	365
SspI	AATATT	2 cut(s)	652, 721
SspMI	CTAG	2 cut(s)	561, 1239
SstI	GAGCTC	2 cut(s)	90, 643
StyD4I	CCNGG	4 cut(s)	19, 57, 337, 1308
StyI	CCWWGG	2 cut(s)	909, 1218
TaaI	ACNGT	4 cut(s)	312, 575, 1124, 1210
TaiI	ACGT	2 cut(s)	694, 871
TaqI	TCGA	6 cut(s)	84, 250, 411, 446, 757, 1117
TatI	WGTACW	2 cut(s)	739, 1085
TfiI	GAWTC	5 cut(s)	76, 452, 749, 821, 852
Tru1I	TTAA	3 cut(s)	216, 351, 1302
Tru9I	TTAA	3 cut(s)	216, 351, 1302
TscAI	CASTG	4 cut(s)	55, 664, 670, 847
TseFI	GTSAC	3 cut(s)	659, 802, 1234
TseI	GCWGC	1 cut(s)	1328
Tsp45I	GTSAC	3 cut(s)	659, 802, 1234
TspDTI	ATGAA	2 cut(s)	1191, 1284
TspGWI	ACGGA	2 cut(s)	34, 779
TspRI	CASTG	4 cut(s)	55, 664, 670, 847
Tth111I	GACNNNGTC	1 cut(s)	800
Van91I	CCANNNNNTGG	1 cut(s)	968
VpaK11BI	GGWCC	2 cut(s)	302, 425
XapI	RAATTY	5 cut(s)	164, 472, 538, 684, 1098
XceI	RCATGY	2 cut(s)	1031, 1185
XmnI	GAANNNNTTC	1 cut(s)	1174
XspI	CTAG	2 cut(s)	561, 1239
ZrmI	AGTACT	1 cut(s)	741

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.