Rmu_sc0001195.1_g000023

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001195.1
OG0020067
Physical Location & Seq
Forward (+)
107910 .. 111208
3299 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001195.1_g000023.1.cds

Sequence Viewer

Length: 735 bp
atgaagcctataaggaatttacaaataccggtagagcttcttgctattcaaaccggattggcatttgtgcaacagcaatgtactcactcagtcctcgttgagacggattgccaaagagctgtacatgacatcaatggatcagctgctatcctgtctaaacatggaattttagttgaagacatccggaacaccttaagacgtatgccacaagtcaaggtgtcttttgctcccagaacatgcaacgaggttgcacatagttgcaggtcgggtcgatgcccagaaacctgcaaccctgacctcctccgatctcaatcgctgcccaaacgcgtctgggaagcctctggcctccgtccggcaagctccatgttgtcgttgctgcctggaacagcctgttgcgtcgccgtccgcaccttagcgaaacccatcacacagcctacagaccccgcctcagccttgcacaagcgctgcacacacgccgcaacacacgggactacagcacttgcaagcctcaatcttccagtagcccaactccgcgcatcagcccgcaacagccacttcggcaacccacccgcctacgctccagcgccctccccgcctgcgcagatcccagctgccacagctcgccttaacaactcgcgtgcggcctctcaccaaacaggccttagccctgccgccaacccggtctcctccacacccgtccggccaacatccagatccgcgatgccaacatcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

244

Amino Acids

25.87

Weight (kDa)

10.19

Isoelectric Point (pI)

62.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020067)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001195.1_g000023
rosa_samantha Rh2CG506000 Rh4AG405400 Rh4BG416400 Rh4CG430900 Rh4DG412000 Rh7DG432300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 600
Acc36I ACCTGC 2 cut(s) 252, 293
AccII CGCG 4 cut(s) 327, 534, 637, 719
AccIII TCCGGA 1 cut(s) 183
AclWI GGATC 3 cut(s) 145, 598, 708
AcoI YGGCCR 1 cut(s) 701
AcsI RAATTY 2 cut(s) 16, 165
AfaI GTAC 2 cut(s) 82, 123
AfeI AGCGCT 1 cut(s) 464
AfiI CCNNNNNNNGG 1 cut(s) 352
AflII CTTAAG 1 cut(s) 193
AflIII ACRYGT 1 cut(s) 325
AgeI ACCGGT 1 cut(s) 28
AgsI TTSAA 2 cut(s) 50, 176
AjnI CCWGG 1 cut(s) 379
AluBI AGCT 6 cut(s) 37, 119, 143, 360, 611, 620
AluI AGCT 6 cut(s) 37, 119, 143, 360, 611, 620
Alw26I GTCTC 2 cut(s) 95, 688
AlwI GGATC 3 cut(s) 145, 598, 708
Aor13HI TCCGGA 1 cut(s) 183
Aor51HI AGCGCT 1 cut(s) 464
AoxI GGCC 4 cut(s) 343, 642, 658, 701
ApeKI GCWGC 5 cut(s) 143, 316, 376, 465, 611
ApoI RAATTY 2 cut(s) 16, 165
AsiGI ACCGGT 1 cut(s) 28
AspLEI GCGC 4 cut(s) 465, 536, 586, 601
AsuC2I CCSGG 1 cut(s) 680
AsuHPI GGTGA 1 cut(s) 641
BbsI GAAGAC 1 cut(s) 183
BbvCI CCTCAGC 1 cut(s) 448
BbvI GCAGC 5 cut(s) 130, 303, 363, 452, 598
BccI CCATC 1 cut(s) 431
BceAI ACGGC 1 cut(s) 386
BciT130I CCWGG 1 cut(s) 381
BcnI CCSGG 1 cut(s) 680
BcoDI GTCTC 2 cut(s) 95, 688
BfaI CTAG 1 cut(s) 733
BfmI CTRYAG 2 cut(s) 435, 492
BfoI RGCGCY 2 cut(s) 466, 587
BfrI CTTAAG 1 cut(s) 193
BfuAI ACCTGC 2 cut(s) 252, 293
BglI GCCNNNNNGGC 1 cut(s) 558
BisI GCNGC 8 cut(s) 144, 317, 377, 466, 477, 612, 642, 672
BlsI GCNGC 8 cut(s) 145, 318, 378, 467, 478, 613, 643, 673
Bme1390I CCNGG 2 cut(s) 381, 680
BmrFI CCNGG 2 cut(s) 381, 680
BmsI GCATC 3 cut(s) 263, 545, 711
BpiI GAAGAC 1 cut(s) 183
BpmI CTGGAG 1 cut(s) 564
Bpu10I CCTNAGC 3 cut(s) 412, 448, 662
BpuMI CCSGG 1 cut(s) 680
BsaBI GATNNNNATC 1 cut(s) 310
BsaI GGTCTC 1 cut(s) 688
BsaWI WCCGGW 3 cut(s) 28, 53, 183
BsaXI ACNNNNNCTCC 2 cut(s) 668, 698
Bsc4I CCNNNNNNNGG 1 cut(s) 352
Bse118I RCCGGY 1 cut(s) 28
Bse1I ACTGG 1 cut(s) 518
Bse3DI GCAATG 1 cut(s) 83
Bse8I GATNNNNATC 1 cut(s) 310
BseAI TCCGGA 1 cut(s) 183
BseBI CCWGG 1 cut(s) 381
BseGI GGATG 3 cut(s) 180, 707, 728
BseJI GATNNNNATC 1 cut(s) 310
BseLI CCNNNNNNNGG 1 cut(s) 352
BseMI GCAATG 1 cut(s) 83
BseMII CTCAG 2 cut(s) 102, 462
BseNI ACTGG 1 cut(s) 518
BseRI GAGGAG 2 cut(s) 290, 676
BseXI GCAGC 5 cut(s) 130, 303, 363, 452, 598
BseYI CCCAGC 1 cut(s) 607
BsgI GTGCAG 1 cut(s) 451
Bsh1236I CGCG 4 cut(s) 327, 534, 637, 719
BshFI GGCC 4 cut(s) 345, 644, 660, 703
BshTI ACCGGT 1 cut(s) 28
BsiSI CCGG 6 cut(s) 29, 54, 184, 353, 680, 700
BslFI GGGAC 1 cut(s) 502
BslI CCNNNNNNNGG 1 cut(s) 352
BsmAI GTCTC 2 cut(s) 95, 688
BsmBI CGTCTC 1 cut(s) 95
BsmFI GGGAC 1 cut(s) 502
BsnI GGCC 4 cut(s) 345, 644, 660, 703
Bso31I GGTCTC 1 cut(s) 688
Bsp13I TCCGGA 1 cut(s) 183
Bsp1407I TGTACA 1 cut(s) 121
Bsp143I GATC 4 cut(s) 137, 305, 603, 713
BspANI GGCC 4 cut(s) 345, 644, 660, 703
BspCNI CTCAG 2 cut(s) 101, 461
BspEI TCCGGA 1 cut(s) 183
BspFNI CGCG 4 cut(s) 327, 534, 637, 719
BspMI ACCTGC 2 cut(s) 252, 293
BspPI GGATC 3 cut(s) 145, 598, 708
BspTI CTTAAG 1 cut(s) 193
BspTNI GGTCTC 1 cut(s) 688
BsrDI GCAATG 1 cut(s) 83
BsrFI RCCGGY 1 cut(s) 28
BsrGI TGTACA 1 cut(s) 121
BsrI ACTGG 1 cut(s) 518
BssAI RCCGGY 1 cut(s) 28
BssMI GATC 4 cut(s) 137, 305, 603, 713
Bst2UI CCWGG 1 cut(s) 381
BstAFI CTTAAG 1 cut(s) 193
BstAUI TGTACA 1 cut(s) 121
BstC8I GCNNGC 6 cut(s) 358, 505, 544, 597, 622, 639
BstDEI CTNAG 4 cut(s) 88, 412, 448, 662
BstF5I GGATG 3 cut(s) 180, 707, 728
BstFNI CGCG 4 cut(s) 327, 534, 637, 719
BstH2I RGCGCY 2 cut(s) 466, 587
BstHHI GCGC 4 cut(s) 465, 536, 586, 601
BstKTI GATC 4 cut(s) 140, 308, 606, 716
BstMAI GTCTC 2 cut(s) 95, 688
BstMBI GATC 4 cut(s) 137, 305, 603, 713
BstMWI GCNNNNNNNGC 3 cut(s) 558, 592, 617
BstNI CCWGG 1 cut(s) 381
BstNSI RCATGY 1 cut(s) 240
BstSCI CCNGG 2 cut(s) 379, 678
BstSFI CTRYAG 2 cut(s) 435, 492
BstUI CGCG 4 cut(s) 327, 534, 637, 719
BstV1I GCAGC 5 cut(s) 130, 303, 363, 452, 598
BstV2I GAAGAC 1 cut(s) 183
BstX2I RGATCY 2 cut(s) 603, 713
BstYI RGATCY 2 cut(s) 603, 713
BsuRI GGCC 4 cut(s) 345, 644, 660, 703
BtsCI GGATG 3 cut(s) 180, 707, 728
BveI ACCTGC 2 cut(s) 252, 293
Cac8I GCNNGC 6 cut(s) 358, 505, 544, 597, 622, 639
CfoI GCGC 4 cut(s) 465, 536, 586, 601
Cfr10I RCCGGY 1 cut(s) 28
CseI GACGC 2 cut(s) 316, 385
Csp6I GTAC 2 cut(s) 81, 122
CspAI ACCGGT 1 cut(s) 28
CviAII CATG 4 cut(s) 125, 161, 237, 364
CviQI GTAC 2 cut(s) 81, 122
DdeI CTNAG 4 cut(s) 88, 412, 448, 662
DpnI GATC 4 cut(s) 139, 307, 605, 715
DpnII GATC 4 cut(s) 137, 305, 603, 713
EaeI YGGCCR 1 cut(s) 701
Eco147I AGGCCT 1 cut(s) 660
Eco31I GGTCTC 1 cut(s) 688
Eco47III AGCGCT 1 cut(s) 464
EcoRII CCWGG 1 cut(s) 379
Esp3I CGTCTC 1 cut(s) 95
FaeI CATG 4 cut(s) 128, 164, 240, 367
FaiI YATR 7 cut(s) 11, 126, 162, 203, 238, 255, 365
FaqI GGGAC 1 cut(s) 502
FatI CATG 4 cut(s) 124, 160, 236, 363
FauI CCCGC 4 cut(s) 451, 551, 577, 600
Fnu4HI GCNGC 8 cut(s) 144, 317, 377, 466, 477, 612, 642, 672
FokI GGATG 3 cut(s) 167, 694, 715
Fsp4HI GCNGC 8 cut(s) 144, 317, 377, 466, 477, 612, 642, 672
FspBI CTAG 1 cut(s) 733
FspI TGCGCA 1 cut(s) 600
GlaI GCGC 4 cut(s) 464, 535, 585, 600
GluI GCNGC 8 cut(s) 144, 317, 377, 466, 477, 612, 642, 672
GsaI CCCAGC 1 cut(s) 611
GsuI CTGGAG 1 cut(s) 564
HaeII RGCGCY 2 cut(s) 466, 587
HaeIII GGCC 4 cut(s) 345, 644, 660, 703
HapII CCGG 6 cut(s) 29, 54, 184, 353, 680, 700
HgaI GACGC 2 cut(s) 316, 385
HhaI GCGC 4 cut(s) 465, 536, 586, 601
Hin1II CATG 4 cut(s) 128, 164, 240, 367
Hin6I GCGC 4 cut(s) 463, 534, 584, 599
HinP1I GCGC 4 cut(s) 463, 534, 584, 599
HpaII CCGG 6 cut(s) 29, 54, 184, 353, 680, 700
HphI GGTGA 1 cut(s) 641
Hpy188I TCNGA 1 cut(s) 305
Hpy188III TCNNGA 2 cut(s) 184, 711
Hpy99I CGWCG 1 cut(s) 401
HpyCH4IV ACGT 1 cut(s) 199
HpyCH4V TGCA 8 cut(s) 70, 240, 251, 261, 288, 457, 468, 503
HpyF10VI GCNNNNNNNGC 3 cut(s) 558, 592, 617
HpyF3I CTNAG 4 cut(s) 88, 412, 448, 662
HpySE526I ACGT 1 cut(s) 199
Hsp92II CATG 4 cut(s) 128, 164, 240, 367
HspAI GCGC 4 cut(s) 463, 534, 584, 599
Kpn2I TCCGGA 1 cut(s) 183
Kzo9I GATC 4 cut(s) 137, 305, 603, 713
LmnI GCTCC 3 cut(s) 232, 365, 583
Lsp1109I GCAGC 5 cut(s) 130, 303, 363, 452, 598
LweI GCATC 3 cut(s) 263, 545, 711
MaeI CTAG 1 cut(s) 733
MaeII ACGT 1 cut(s) 199
MalI GATC 4 cut(s) 139, 307, 605, 715
MboI GATC 4 cut(s) 137, 305, 603, 713
MboII GAAGA 2 cut(s) 188, 506
MflI RGATCY 2 cut(s) 603, 713
MluCI AATT 2 cut(s) 16, 165
MluI ACGCGT 1 cut(s) 325
MroI TCCGGA 1 cut(s) 183
MseI TTAA 2 cut(s) 194, 627
MspA1I CMGCKG 2 cut(s) 143, 611
MspCI CTTAAG 1 cut(s) 193
MspI CCGG 6 cut(s) 29, 54, 184, 353, 680, 700
MspR9I CCNGG 2 cut(s) 381, 680
MvaI CCWGG 1 cut(s) 381
MvnI CGCG 4 cut(s) 327, 534, 637, 719
MwoI GCNNNNNNNGC 3 cut(s) 558, 592, 617
NciI CCSGG 1 cut(s) 680
NdeII GATC 4 cut(s) 137, 305, 603, 713
NlaIII CATG 4 cut(s) 128, 164, 240, 367
NsbI TGCGCA 1 cut(s) 600
NspI RCATGY 1 cut(s) 240
PceI AGGCCT 1 cut(s) 660
PinAI ACCGGT 1 cut(s) 28
PkrI GCNGC 8 cut(s) 145, 318, 378, 467, 478, 613, 643, 673
Psp6I CCWGG 1 cut(s) 379
PspFI CCCAGC 1 cut(s) 607
PspGI CCWGG 1 cut(s) 379
PsuI RGATCY 2 cut(s) 603, 713
PvuII CAGCTG 2 cut(s) 143, 611
RsaI GTAC 2 cut(s) 82, 123
RsaNI GTAC 2 cut(s) 81, 122
SaqAI TTAA 2 cut(s) 194, 627
SatI GCNGC 8 cut(s) 144, 317, 377, 466, 477, 612, 642, 672
Sau3AI GATC 4 cut(s) 137, 305, 603, 713
ScrFI CCNGG 2 cut(s) 381, 680
SfaNI GCATC 3 cut(s) 263, 545, 711
SfcI CTRYAG 2 cut(s) 435, 492
SmlI CTYRAG 1 cut(s) 193
SmoI CTYRAG 1 cut(s) 193
Sse9I AATT 2 cut(s) 16, 165
SseBI AGGCCT 1 cut(s) 660
SspMI CTAG 1 cut(s) 733
StuI AGGCCT 1 cut(s) 660
StyD4I CCNGG 2 cut(s) 379, 678
TaiI ACGT 1 cut(s) 202
TaqI TCGA 1 cut(s) 271
TasI AATT 2 cut(s) 16, 165
TatI WGTACW 2 cut(s) 80, 121
TauI GCSGC 3 cut(s) 479, 644, 674
Tru1I TTAA 2 cut(s) 194, 627
Tru9I TTAA 2 cut(s) 194, 627
TseI GCWGC 5 cut(s) 143, 316, 376, 465, 611
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 2 cut(s) 119, 338
Vha464I CTTAAG 1 cut(s) 193
XapI RAATTY 2 cut(s) 16, 165
XceI RCATGY 1 cut(s) 240
XspI CTAG 1 cut(s) 733
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.