Rmu_sc0001386.1_g000002

Belongs to the glycosyl hydrolase 5 (cellulase A) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001386.1
Physical Location & Seq
Reverse (-)
6009 .. 9836
3828 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001386.1_g000002.1.cds

Sequence Viewer

Length: 1584 bp
atggaacttgttcttagcaaatgggtttccgcatttctattctgctcttggttcatcttctctccagtatactcagtggtgggattgcatggtgactctaaagtgagagcagtaaatttgggagggtggttggtagtggaaggctggatcaagccttcactttttgatggcattcccaatggagatatgcttgatggaacagtggtacaattaaagtcggtaactttggataagtatgtctctgcagaaaatgggggaggggccaatgtctctgttagtagagatgctgcatcttcatgggaaacgcttaggttatggagagtttctgaaacagaatttcatttccgcacttcgcttggacagtttctaacttgtgatggtggtgacggttgctttatttctgcaactgcagtatcaccttcgacatcatttttcgttgaaagaaataacgggagggttcacatcaaaacaatgagtggcacatatttgcaggctacaatggcaaatcagcttgtggcaaactatccagggaaaccaggatgggatgataatgcagccacatttgaaatgaccattgttgctaataacttgcatggagactaccagcttgcgaatggatatggacacaataagggcaaagctgttctcaagaggcataggaacagtttcatcactataggagatttcaattttctgtctagacatggaataaatactgtgaggatccctgttggctggtggattgcttatgatccagatcctcctgcaccatttattggtggaactttggaagctctagacaatgcattctcatgggcacaatcatataatattaggtgcatcattgaccttcatgcggcccctggctctcagaatgggatggaacatagtgctagtagggatggttcaactgattggcctactccagattccatttcacaaacattgcacgttatagactttctaatttccaggtatgcaagacggcctgctttgctgggaattgagcttttgaatgaaccatctgctgctactgttccattggacagtttagtttcgtattacaaacaaggttatgaagttgttcggaaatactcgtcaacaacttatgtaataatttgtcaaagaattggcaatgcagatccattggaactttttcaggctgacattggctcacataatattgtggtggatttgcattattacaatctttttgacaattactttgtcaacatgagccctacggataatatacaattcatatacaagagcagggaaactcaattgcaggccctgaacagtgcaaacggtccacttgtttttattggagagtgggtcaacgagtggaatgtaacgaatgcctcacagacagattatcaagactttgggagggtccagttagaagtttacaatgctgcttcatttggatgggcttactggacactgaagaatgatagacctcactgggattttgaatggaacattagaaacaatcatcttcgattgagtagttcgcccaacatacggaatgtttacagtttagtgtcgcttgtattactgttctatctgcatcatatcttgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

527

Amino Acids

59.13

Weight (kDa)

5.79

Isoelectric Point (pI)

36.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015519)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 776
AccI GTMKAC 1 cut(s) 69
AciI CCGC 3 cut(s) 30, 346, 857
AclWI GGATC 6 cut(s) 155, 718, 731, 746, 752, 1136
AcsI RAATTY 2 cut(s) 115, 335
AcuI CTGAAG 1 cut(s) 1466
AfaI GTAC 1 cut(s) 207
AfiI CCNNNNNNNGG 3 cut(s) 776, 856, 1524
AgsI TTSAA 6 cut(s) 440, 566, 688, 909, 1015, 1475
AjnI CCWGG 4 cut(s) 526, 535, 862, 971
AluBI AGCT 5 cut(s) 511, 607, 641, 794, 1009
AluI AGCT 5 cut(s) 511, 607, 641, 794, 1009
Alw26I GTCTC 3 cut(s) 244, 274, 591
AlwI GGATC 6 cut(s) 155, 718, 731, 746, 752, 1136
AlwNI CAGNNNCTG 1 cut(s) 1294
AoxI GGCC 5 cut(s) 261, 858, 917, 986, 1290
ApeKI GCWGC 4 cut(s) 287, 554, 1028, 1415
ApoI RAATTY 2 cut(s) 115, 335
ArsI GACNNNNNNTTYG 2 cut(s) 1208, 1240
Asp700I GAANNNNTTC 4 cut(s) 9, 665, 1083, 1155
AspS9I GGNCC 5 cut(s) 261, 859, 1291, 1310, 1393
AsuHPI GGTGA 3 cut(s) 104, 395, 408
AvaII GGWCC 2 cut(s) 1310, 1393
BaeGI GKGCMC 1 cut(s) 820
BaeI ACNNNNGTAYC 2 cut(s) 396, 429
BamHI GGATCC 1 cut(s) 723
BanII GRGCYC 1 cut(s) 1241
BbvI GCAGC 4 cut(s) 274, 566, 1015, 1402
BccI CCATC 8 cut(s) 161, 188, 371, 534, 874, 896, 1030, 1422
BceAI ACGGC 1 cut(s) 1001
BciT130I CCWGG 4 cut(s) 528, 537, 864, 973
BcoDI GTCTC 3 cut(s) 244, 274, 591
BfaI CTAG 3 cut(s) 699, 797, 894
BfmI CTRYAG 3 cut(s) 243, 408, 675
BisI GCNGC 5 cut(s) 288, 555, 858, 1029, 1416
BlsI GCNGC 5 cut(s) 289, 556, 859, 1030, 1417
Bme1390I CCNGG 4 cut(s) 528, 537, 864, 973
Bme18I GGWCC 2 cut(s) 1310, 1393
BmgT120I GGNCC 5 cut(s) 261, 859, 1291, 1310, 1393
BmiI GGNNCC 4 cut(s) 262, 725, 861, 1394
BmrFI CCNGG 4 cut(s) 528, 537, 864, 973
BmrI ACTGGG 1 cut(s) 1474
BmsI GCATC 4 cut(s) 274, 299, 849, 1579
BmuI ACTGGG 1 cut(s) 1474
BpmI CTGGAG 2 cut(s) 48, 909
Bpu10I CCTNAGC 1 cut(s) 308
BpuEI CTTGAG 1 cut(s) 632
BsaBI GATNNNNATC 1 cut(s) 756
BsaJI CCNNGG 2 cut(s) 527, 862
BsaXI ACNNNNNCTCC 2 cut(s) 1320, 1350
Bsc4I CCNNNNNNNGG 3 cut(s) 776, 856, 1524
Bse1I ACTGG 4 cut(s) 65, 1396, 1442, 1469
Bse3DI GCAATG 2 cut(s) 944, 1141
Bse8I GATNNNNATC 1 cut(s) 756
BseBI CCWGG 4 cut(s) 528, 537, 864, 973
BseDI CCNNGG 2 cut(s) 527, 862
BseGI GGATG 5 cut(s) 545, 550, 885, 907, 1433
BseJI GATNNNNATC 1 cut(s) 756
BseLI CCNNNNNNNGG 3 cut(s) 776, 856, 1524
BseMI GCAATG 2 cut(s) 944, 1141
BseMII CTCAG 2 cut(s) 87, 884
BseNI ACTGG 4 cut(s) 65, 1396, 1442, 1469
BseSI GKGCMC 1 cut(s) 820
BseXI GCAGC 4 cut(s) 274, 566, 1015, 1402
BseYI CCCAGC 1 cut(s) 997
BsgI GTGCAG 1 cut(s) 750
BshFI GGCC 5 cut(s) 263, 860, 919, 988, 1292
BslI CCNNNNNNNGG 3 cut(s) 776, 856, 1524
BsmAI GTCTC 3 cut(s) 244, 274, 591
BsmI GAATGC 3 cut(s) 171, 806, 1363
BsnI GGCC 5 cut(s) 263, 860, 919, 988, 1292
Bsp1286I GDGCHC 2 cut(s) 820, 1241
Bsp143I GATC 5 cut(s) 147, 723, 751, 757, 1141
BspACI CCGC 3 cut(s) 30, 346, 857
BspANI GGCC 5 cut(s) 263, 860, 919, 988, 1292
BspCNI CTCAG 2 cut(s) 86, 883
BspLI GGNNCC 4 cut(s) 262, 725, 861, 1394
BspMAI CTGCAG 2 cut(s) 247, 412
BspPI GGATC 6 cut(s) 155, 718, 731, 746, 752, 1136
BsrDI GCAATG 2 cut(s) 944, 1141
BsrI ACTGG 4 cut(s) 65, 1396, 1442, 1469
BssECI CCNNGG 2 cut(s) 527, 862
BssMI GATC 5 cut(s) 147, 723, 751, 757, 1141
BssNAI GTATAC 1 cut(s) 70
Bst1107I GTATAC 1 cut(s) 70
Bst2UI CCWGG 4 cut(s) 528, 537, 864, 973
BstC8I GCNNGC 4 cut(s) 492, 609, 990, 1290
BstDEI CTNAG 4 cut(s) 14, 73, 308, 870
BstF5I GGATG 5 cut(s) 545, 550, 885, 907, 1433
BstKTI GATC 5 cut(s) 150, 726, 754, 760, 1144
BstMAI GTCTC 3 cut(s) 244, 274, 591
BstMBI GATC 5 cut(s) 147, 723, 751, 757, 1141
BstMWI GCNNNNNNNGC 2 cut(s) 500, 994
BstNI CCWGG 4 cut(s) 528, 537, 864, 973
BstSCI CCNGG 4 cut(s) 526, 535, 862, 971
BstSFI CTRYAG 3 cut(s) 243, 408, 675
BstSLI GKGCMC 1 cut(s) 820
BstV1I GCAGC 4 cut(s) 274, 566, 1015, 1402
BstX2I RGATCY 3 cut(s) 723, 757, 1141
BstYI RGATCY 3 cut(s) 723, 757, 1141
BstZ17I GTATAC 1 cut(s) 70
BsuRI GGCC 5 cut(s) 263, 860, 919, 988, 1292
BtsCI GGATG 5 cut(s) 545, 550, 885, 907, 1433
BtsIMutI CAGTG 5 cut(s) 81, 207, 1306, 1442, 1462
Cac8I GCNNGC 4 cut(s) 492, 609, 990, 1290
CaiI CAGNNNCTG 1 cut(s) 1294
Cfr13I GGNCC 5 cut(s) 261, 859, 1291, 1310, 1393
Csp6I GTAC 1 cut(s) 206
CviAII CATG 7 cut(s) 89, 297, 593, 704, 813, 854, 1234
CviQI GTAC 1 cut(s) 206
DdeI CTNAG 4 cut(s) 14, 73, 308, 870
DpnI GATC 5 cut(s) 149, 725, 753, 759, 1143
DpnII GATC 5 cut(s) 147, 723, 751, 757, 1141
Eco24I GRGCYC 1 cut(s) 1241
Eco47I GGWCC 2 cut(s) 1310, 1393
Eco57I CTGAAG 1 cut(s) 1466
EcoO109I RGGNCCY 1 cut(s) 1291
EcoRII CCWGG 4 cut(s) 526, 535, 862, 971
EcoT22I ATGCAT 1 cut(s) 808
EcoT38I GRGCYC 1 cut(s) 1241
FaeI CATG 7 cut(s) 92, 300, 596, 707, 816, 857, 1237
FatI CATG 7 cut(s) 88, 296, 592, 703, 812, 853, 1233
FblI GTMKAC 1 cut(s) 69
Fnu4HI GCNGC 5 cut(s) 288, 555, 858, 1029, 1416
FokI GGATG 5 cut(s) 552, 557, 892, 914, 1440
FriOI GRGCYC 1 cut(s) 1241
Fsp4HI GCNGC 5 cut(s) 288, 555, 858, 1029, 1416
FspBI CTAG 3 cut(s) 699, 797, 894
GluI GCNGC 5 cut(s) 288, 555, 858, 1029, 1416
GsaI CCCAGC 1 cut(s) 1001
GsuI CTGGAG 2 cut(s) 48, 909
HaeIII GGCC 5 cut(s) 263, 860, 919, 988, 1292
Hin1II CATG 7 cut(s) 92, 300, 596, 707, 816, 857, 1237
HincII GTYRAC 3 cut(s) 1101, 1231, 1339
HindII GTYRAC 3 cut(s) 1101, 1231, 1339
HinfI GANTC 2 cut(s) 95, 929
HphI GGTGA 3 cut(s) 104, 395, 408
Hpy166II GTNNAC 8 cut(s) 70, 460, 1101, 1231, 1313, 1339, 1408, 1534
Hpy188I TCNGA 3 cut(s) 328, 873, 1089
Hpy188III TCNNGA 6 cut(s) 649, 699, 755, 797, 926, 1379
Hpy8I GTNNAC 8 cut(s) 70, 460, 1101, 1231, 1313, 1339, 1408, 1534
HpyAV CCTTC 4 cut(s) 134, 165, 429, 860
HpyCH4IV ACGT 1 cut(s) 951
HpyF10VI GCNNNNNNNGC 2 cut(s) 500, 994
HpyF3I CTNAG 4 cut(s) 14, 73, 308, 870
HpySE526I ACGT 1 cut(s) 951
Hsp92II CATG 7 cut(s) 92, 300, 596, 707, 816, 857, 1237
Kzo9I GATC 5 cut(s) 147, 723, 751, 757, 1141
Lsp1109I GCAGC 4 cut(s) 274, 566, 1015, 1402
LweI GCATC 4 cut(s) 274, 299, 849, 1579
MaeI CTAG 3 cut(s) 699, 797, 894
MaeII ACGT 1 cut(s) 951
MaeIII GTNAC 4 cut(s) 92, 220, 383, 1351
MalI GATC 5 cut(s) 149, 725, 753, 759, 1143
MboI GATC 5 cut(s) 147, 723, 751, 757, 1141
MboII GAAGA 4 cut(s) 49, 285, 1459, 1490
MfeI CAATTG 1 cut(s) 1283
MflI RGATCY 3 cut(s) 723, 757, 1141
MhlI GDGCHC 2 cut(s) 820, 1241
MlyI GAGTC 1 cut(s) 89
MnlI CCTC 9 cut(s) 116, 251, 447, 645, 714, 771, 1372, 1383, 1470
Mph1103I ATGCAT 1 cut(s) 808
MroXI GAANNNNTTC 4 cut(s) 9, 665, 1083, 1155
MseI TTAA 1 cut(s) 212
MslI CAYNNNNRTG 3 cut(s) 295, 811, 1426
MspR9I CCNGG 4 cut(s) 528, 537, 864, 973
MunI CAATTG 1 cut(s) 1283
Mva1269I GAATGC 3 cut(s) 171, 806, 1363
MvaI CCWGG 4 cut(s) 528, 537, 864, 973
MwoI GCNNNNNNNGC 2 cut(s) 500, 994
NdeII GATC 5 cut(s) 147, 723, 751, 757, 1141
NlaIII CATG 7 cut(s) 92, 300, 596, 707, 816, 857, 1237
NlaIV GGNNCC 4 cut(s) 262, 725, 861, 1394
NmuCI GTSAC 2 cut(s) 92, 383
NsiI ATGCAT 1 cut(s) 808
PctI GAATGC 3 cut(s) 171, 806, 1363
PdmI GAANNNNTTC 4 cut(s) 9, 665, 1083, 1155
PfeI GAWTC 1 cut(s) 929
PflMI CCANNNNNTGG 1 cut(s) 776
PkrI GCNGC 5 cut(s) 289, 556, 859, 1030, 1417
PleI GAGTC 1 cut(s) 89
PpsI GAGTC 1 cut(s) 89
Psp6I CCWGG 4 cut(s) 526, 535, 862, 971
PspFI CCCAGC 1 cut(s) 997
PspGI CCWGG 4 cut(s) 526, 535, 862, 971
PspN4I GGNNCC 4 cut(s) 262, 725, 861, 1394
PspPI GGNCC 5 cut(s) 261, 859, 1291, 1310, 1393
PsrI GAACNNNNNNTAC 2 cut(s) 889, 921
PstI CTGCAG 2 cut(s) 247, 412
PstNI CAGNNNCTG 1 cut(s) 1294
PsuI RGATCY 3 cut(s) 723, 757, 1141
RsaI GTAC 1 cut(s) 207
RsaNI GTAC 1 cut(s) 206
RseI CAYNNNNRTG 3 cut(s) 295, 811, 1426
SaqAI TTAA 1 cut(s) 212
SatI GCNGC 5 cut(s) 288, 555, 858, 1029, 1416
Sau3AI GATC 5 cut(s) 147, 723, 751, 757, 1141
Sau96I GGNCC 5 cut(s) 261, 859, 1291, 1310, 1393
SchI GAGTC 1 cut(s) 89
ScrFI CCNGG 4 cut(s) 528, 537, 864, 973
SduI GDGCHC 2 cut(s) 820, 1241
SfaNI GCATC 4 cut(s) 274, 299, 849, 1579
SfcI CTRYAG 3 cut(s) 243, 408, 675
SinI GGWCC 2 cut(s) 1310, 1393
SmiMI CAYNNNNRTG 3 cut(s) 295, 811, 1426
SmlI CTYRAG 1 cut(s) 647
SmoI CTYRAG 1 cut(s) 647
SsiI CCGC 3 cut(s) 30, 346, 857
SspI AATATT 2 cut(s) 832, 1183
SspMI CTAG 3 cut(s) 699, 797, 894
StyD4I CCNGG 4 cut(s) 526, 535, 862, 971
TaiI ACGT 1 cut(s) 954
TaqI TCGA 2 cut(s) 422, 1501
TauI GCSGC 1 cut(s) 860
TfiI GAWTC 1 cut(s) 929
Tru1I TTAA 1 cut(s) 212
Tru9I TTAA 1 cut(s) 212
TscAI CASTG 5 cut(s) 81, 207, 1306, 1449, 1469
TseFI GTSAC 2 cut(s) 92, 383
TseI GCWGC 4 cut(s) 287, 554, 1028, 1415
Tsp45I GTSAC 2 cut(s) 92, 383
TspDTI ATGAA 9 cut(s) 43, 285, 329, 658, 842, 1032, 1092, 1249, 1410
TspGWI ACGGA 2 cut(s) 1259, 1540
TspRI CASTG 5 cut(s) 81, 207, 1306, 1449, 1469
Van91I CCANNNNNTGG 1 cut(s) 776
VpaK11BI GGWCC 2 cut(s) 1310, 1393
XapI RAATTY 2 cut(s) 115, 335
XbaI TCTAGA 2 cut(s) 698, 796
XcmI CCANNNNNNNNNTGG 1 cut(s) 611
XmiI GTMKAC 1 cut(s) 69
XmnI GAANNNNTTC 4 cut(s) 9, 665, 1083, 1155
XspI CTAG 3 cut(s) 699, 797, 894
Zsp2I ATGCAT 1 cut(s) 808
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.