Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001512.1

Orthogroup ID

OG0019092

Physical Location & Seq

Genomic Coordinates Forward (+)

9440 .. 12937

Gene Structure 3498 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 735 bp

atgggagaggaggaggtcggaggaggccggaggaggtcggatgaggccggagcaatgggagagtggaggaggccggagcaatgggagaggaggaagtcggaggaggctctagaagctggacggaaggtattggatcttactaataataagagaattgatgctgagttattggaaagaattatcacagaggtggaaagcatggcttcacctaataattcagcaatgactgatgatgaagataactttctcgtttgtgggaccacaaatgcagcatctgaggtgggaaaatctcgggaagctgagcacttaggctatgtttggtatggctgttccttgagaaaaagctggcttctgcttatttctgagaataagtggctgaaaagcaaagctgctgagtgtttgagggagaccgagcagaggagatcgaccggagaccgagcagaggagatcgagcggagatcaagcggagaccgagcagaggagatagaccggagaacgagcagagggagaccgagcagaggagatcgaccggagaccgagcagagggagatcgagcggatggagatgggagatcgagcagggattggatgcgttctggagatgggagatcgagcagagggagatgggagatcgagcagggagatcgagcagagggagatgggagttgggagagagcagagggagatgggagatgggatcgagagactgatggagggtgggtggcatcggctgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

TPR_16 TPR_2 TPR_8

Protein Analysis

244

Amino Acids

27.88

Weight (kDa)

5.07

Isoelectric Point (pI)

73.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019092)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0001512.1_g000002
rosa_rugosa	Rorug01G0055700
rosa_samantha	Rh1AG041900 Rh1BG039400 Rh1CG042900 Rh1DG023800 Rh1DG026200 Rh1DG026700 Rh1DG048000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	2 cut(s)	454, 556
AciI	CCGC	3 cut(s)	454, 465, 556
AclWI	GGATC	2 cut(s)	141, 704
AfiI	CCNNNNNNNGG	5 cut(s)	417, 442, 478, 518, 543
AleI	CACNNNNGTG	1 cut(s)	188
AluBI	AGCT	4 cut(s)	116, 299, 345, 389
AluI	AGCT	4 cut(s)	116, 299, 345, 389
Alw21I	GWGCWC	1 cut(s)	306
Alw26I	GTCTC	6 cut(s)	401, 426, 462, 502, 527, 697
AlwI	GGATC	2 cut(s)	141, 704
AlwNI	CAGNNNCTG	1 cut(s)	275
Ama87I	CYCGRG	1 cut(s)	291
AoxI	GGCC	3 cut(s)	25, 45, 71
ApeKI	GCWGC	2 cut(s)	269, 389
AspS9I	GGNCC	1 cut(s)	258
AsuHPI	GGTGA	1 cut(s)	198
AvaI	CYCGRG	1 cut(s)	291
AvaII	GGWCC	1 cut(s)	258
Bbv12I	GWGCWC	1 cut(s)	306
BbvI	GCAGC	2 cut(s)	281, 376
BccI	CCATC	8 cut(s)	553, 559, 595, 617, 652, 679, 686, 703
BcgI	CGANNNNNNTGC	2 cut(s)	625, 659
BcoDI	GTCTC	6 cut(s)	401, 426, 462, 502, 527, 697
BfaI	CTAG	1 cut(s)	110
BisI	GCNGC	2 cut(s)	270, 390
BlpI	GCTNAGC	1 cut(s)	300
BlsI	GCNGC	2 cut(s)	271, 391
Bme18I	GGWCC	1 cut(s)	258
BmeT110I	CYCGRG	1 cut(s)	291
BmgT120I	GGNCC	1 cut(s)	258
BmiI	GGNNCC	1 cut(s)	259
BmsI	GCATC	3 cut(s)	148, 281, 578
BpmI	CTGGAG	1 cut(s)	617
Bpu1102I	GCTNAGC	1 cut(s)	300
BpuEI	CTTGAG	1 cut(s)	355
BsaI	GGTCTC	5 cut(s)	401, 426, 462, 502, 527
BsaWI	WCCGGW	3 cut(s)	428, 489, 529
BsaXI	ACNNNNNCTCC	2 cut(s)	704, 734
Bsc4I	CCNNNNNNNGG	5 cut(s)	417, 442, 478, 518, 543
Bse3DI	GCAATG	3 cut(s)	60, 86, 228
BseGI	GGATG	3 cut(s)	46, 564, 593
BseLI	CCNNNNNNNGG	5 cut(s)	417, 442, 478, 518, 543
BseMI	GCAATG	3 cut(s)	60, 86, 228
BseMII	CTCAG	5 cut(s)	153, 267, 291, 354, 384
BseXI	GCAGC	2 cut(s)	281, 376
Bsh1285I	CGRYCG	2 cut(s)	429, 530
BshFI	GGCC	3 cut(s)	27, 47, 73
BsiEI	CGRYCG	2 cut(s)	429, 530
BsiHKAI	GWGCWC	1 cut(s)	306
BsiHKCI	CYCGRG	1 cut(s)	291
BsiSI	CCGG	6 cut(s)	28, 48, 74, 429, 490, 530
BslFI	GGGAC	1 cut(s)	271
BslI	CCNNNNNNNGG	5 cut(s)	417, 442, 478, 518, 543
BsmAI	GTCTC	6 cut(s)	401, 426, 462, 502, 527, 697
BsmFI	GGGAC	1 cut(s)	271
BsnI	GGCC	3 cut(s)	27, 47, 73
Bso31I	GGTCTC	5 cut(s)	401, 426, 462, 502, 527
BsoBI	CYCGRG	1 cut(s)	291
Bsp1286I	GDGCHC	1 cut(s)	306
Bsp1720I	GCTNAGC	1 cut(s)	300
BspACI	CCGC	3 cut(s)	454, 465, 556
BspANI	GGCC	3 cut(s)	27, 47, 73
BspCNI	CTCAG	5 cut(s)	154, 268, 292, 355, 385
BspLI	GGNNCC	1 cut(s)	259
BspPI	GGATC	2 cut(s)	141, 704
BspTNI	GGTCTC	5 cut(s)	401, 426, 462, 502, 527
BsrBI	CCGCTC	2 cut(s)	454, 556
BsrDI	GCAATG	3 cut(s)	60, 86, 228
BstC8I	GCNNGC	1 cut(s)	347
BstDEI	CTNAG	6 cut(s)	162, 276, 300, 307, 363, 393
BstF5I	GGATG	3 cut(s)	46, 564, 593
BstMAI	GTCTC	6 cut(s)	401, 426, 462, 502, 527, 697
BstMCI	CGRYCG	2 cut(s)	429, 530
BstMWI	GCNNNNNNNGC	1 cut(s)	113
BstV1I	GCAGC	2 cut(s)	281, 376
BstX2I	RGATCY	1 cut(s)	133
BstYI	RGATCY	1 cut(s)	133
BsuRI	GGCC	3 cut(s)	27, 47, 73
BtsCI	GGATG	3 cut(s)	46, 564, 593
Cac8I	GCNNGC	1 cut(s)	347
CaiI	CAGNNNCTG	1 cut(s)	275
Cfr13I	GGNCC	1 cut(s)	258
CviAII	CATG	1 cut(s)	199
DdeI	CTNAG	6 cut(s)	162, 276, 300, 307, 363, 393
Eco31I	GGTCTC	5 cut(s)	401, 426, 462, 502, 527
Eco47I	GGWCC	1 cut(s)	258
Eco88I	CYCGRG	1 cut(s)	291
FaeI	CATG	1 cut(s)	202
FaiI	YATR	3 cut(s)	200, 315, 324
FalI	AAGNNNNNCTT	2 cut(s)	187, 219
FaqI	GGGAC	1 cut(s)	271
FatI	CATG	1 cut(s)	198
Fnu4HI	GCNGC	2 cut(s)	270, 390
FokI	GGATG	3 cut(s)	53, 571, 600
Fsp4HI	GCNGC	2 cut(s)	270, 390
FspBI	CTAG	1 cut(s)	110
GluI	GCNGC	2 cut(s)	270, 390
GsuI	CTGGAG	1 cut(s)	617
HaeIII	GGCC	3 cut(s)	27, 47, 73
HapII	CCGG	6 cut(s)	28, 48, 74, 429, 490, 530
Hin1II	CATG	1 cut(s)	202
HpaII	CCGG	6 cut(s)	28, 48, 74, 429, 490, 530
HphI	GGTGA	1 cut(s)	198
Hpy188I	TCNGA	5 cut(s)	20, 40, 100, 277, 364
Hpy188III	TCNNGA	4 cut(s)	110, 293, 596, 700
HpyAV	CCTTC	1 cut(s)	118
HpyCH4V	TGCA	1 cut(s)	269
HpyF10VI	GCNNNNNNNGC	1 cut(s)	113
HpyF3I	CTNAG	6 cut(s)	162, 276, 300, 307, 363, 393
Hsp92II	CATG	1 cut(s)	202
LmnI	GCTCC	2 cut(s)	50, 76
Lsp1109I	GCAGC	2 cut(s)	281, 376
LweI	GCATC	3 cut(s)	148, 281, 578
MaeI	CTAG	1 cut(s)	110
MbiI	CCGCTC	2 cut(s)	454, 556
MboII	GAAGA	1 cut(s)	248
MflI	RGATCY	1 cut(s)	133
MhlI	GDGCHC	1 cut(s)	306
MluCI	AATT	3 cut(s)	153, 177, 214
MmeI	TCCRAC	2 cut(s)	18, 78
MslI	CAYNNNNRTG	1 cut(s)	188
MspI	CCGG	6 cut(s)	28, 48, 74, 429, 490, 530
MwoI	GCNNNNNNNGC	1 cut(s)	113
NlaIII	CATG	1 cut(s)	202
NlaIV	GGNNCC	1 cut(s)	259
OliI	CACNNNNGTG	1 cut(s)	188
PkrI	GCNGC	2 cut(s)	271, 391
PspN4I	GGNNCC	1 cut(s)	259
PspPI	GGNCC	1 cut(s)	258
PstNI	CAGNNNCTG	1 cut(s)	275
PsuI	RGATCY	1 cut(s)	133
RseI	CAYNNNNRTG	1 cut(s)	188
SatI	GCNGC	2 cut(s)	270, 390
Sau96I	GGNCC	1 cut(s)	258
SduI	GDGCHC	1 cut(s)	306
SfaNI	GCATC	3 cut(s)	148, 281, 578
SinI	GGWCC	1 cut(s)	258
SmiMI	CAYNNNNRTG	1 cut(s)	188
SmlI	CTYRAG	1 cut(s)	334
SmoI	CTYRAG	1 cut(s)	334
Sse9I	AATT	3 cut(s)	153, 177, 214
SsiI	CCGC	3 cut(s)	454, 465, 556
SspMI	CTAG	1 cut(s)	110
TaqI	TCGA	9 cut(s)	425, 450, 526, 552, 574, 610, 632, 645, 699
TaqII	GACCGA	5 cut(s)	425, 450, 486, 526, 551
TasI	AATT	3 cut(s)	153, 177, 214
TseI	GCWGC	2 cut(s)	269, 389
TspDTI	ATGAA	1 cut(s)	249
TspGWI	ACGGA	1 cut(s)	136
VpaK11BI	GGWCC	1 cut(s)	258
XbaI	TCTAGA	1 cut(s)	109
XspI	CTAG	1 cut(s)	110

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.