Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001598.1

Orthogroup ID

OG0021588

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 281

Gene Structure 280 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001598.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 280 bp

atgagtgtggctactgtgtctccgattttacatactattgataaccttgttgggtatcttaagagggaacgagggttagattctgattacggtgacctagagttgatagatcagagggcaaagaggcttaaggtagagactgatgtgggtatttcagaagaggctagatttgcttttgatgaaaaacccaggttttccaaagtgagatttgggtatatacccaaggggctagtgcttggggatgatgaaattgatcgactacgcaacgaaaacactagga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000428 GO:0003674 GO:0003824 GO:0004721 GO:0004722 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0006355 GO:0006357 GO:0006464 GO:0006470 GO:0006793 GO:0006796 GO:0006807 GO:0006950 GO:0006970 GO:0008022 GO:0008150 GO:0008152 GO:0008420 GO:0009628 GO:0009651 GO:0009889 GO:0009987 GO:0010468 GO:0010556 GO:0016311 GO:0016591 GO:0016787 GO:0016788 GO:0016791 GO:0019219 GO:0019222 GO:0019538 GO:0030880 GO:0031323 GO:0031326 GO:0031974 GO:0031981 GO:0032991 GO:0036211 GO:0042578 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044451 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051171 GO:0051252 GO:0055029 GO:0060255 GO:0061695 GO:0065007 GO:0070013 GO:0070940 GO:0071704 GO:0080090 GO:0140096 GO:1901564 GO:1902494 GO:1903506 GO:1990234 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

BRCT NIF PTCB-BRCT

Protein Analysis

93

Amino Acids

10.67

Weight (kDa)

5.41

Isoelectric Point (pI)

27.45

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021588)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000030184
rosa_multiflora	Rmu_co8021052.1_g000001 Rmu_sc0001425.1_g000010 Rmu_sc0001598.1_g000001
rosa_samantha	Rh1DG069100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AflII	CTTAAG	2 cut(s)	59, 128
AjnI	CCWGG	1 cut(s)	188
Alw26I	GTCTC	2 cut(s)	24, 131
AsuHPI	GGTGA	1 cut(s)	104
BciT130I	CCWGG	1 cut(s)	190
BcoDI	GTCTC	2 cut(s)	24, 131
BfaI	CTAG	4 cut(s)	98, 165, 230, 276
BfrI	CTTAAG	2 cut(s)	59, 128
Bme1390I	CCNGG	1 cut(s)	190
BmrFI	CCNGG	1 cut(s)	190
BsaJI	CCNNGG	2 cut(s)	188, 222
BsaXI	ACNNNNNCTCC	1 cut(s)	34
BseBI	CCWGG	1 cut(s)	190
BseDI	CCNNGG	2 cut(s)	188, 222
BseGI	GGATG	1 cut(s)	247
BsmAI	GTCTC	2 cut(s)	24, 131
Bsp143I	GATC	2 cut(s)	109, 253
BspTI	CTTAAG	2 cut(s)	59, 128
BssECI	CCNNGG	2 cut(s)	188, 222
BssMI	GATC	2 cut(s)	109, 253
BssT1I	CCWWGG	1 cut(s)	222
Bst2UI	CCWGG	1 cut(s)	190
Bst4CI	ACNGT	2 cut(s)	16, 92
Bst6I	CTCTTC	1 cut(s)	153
BstAFI	CTTAAG	2 cut(s)	59, 128
BstEII	GGTNACC	1 cut(s)	92
BstF5I	GGATG	1 cut(s)	247
BstKTI	GATC	2 cut(s)	112, 256
BstMAI	GTCTC	2 cut(s)	24, 131
BstMBI	GATC	2 cut(s)	109, 253
BstMWI	GCNNNNNNNGC	1 cut(s)	170
BstNI	CCWGG	1 cut(s)	190
BstPI	GGTNACC	1 cut(s)	92
BstSCI	CCNGG	1 cut(s)	188
BtsCI	GGATG	1 cut(s)	247
CviJI	RGCY	4 cut(s)	11, 127, 164, 229
CviKI_1	RGCY	4 cut(s)	11, 127, 164, 229
DpnI	GATC	2 cut(s)	111, 255
DpnII	GATC	2 cut(s)	109, 253
Eam1104I	CTCTTC	1 cut(s)	153
EarI	CTCTTC	1 cut(s)	153
Eco130I	CCWWGG	1 cut(s)	222
Eco91I	GGTNACC	1 cut(s)	92
EcoO65I	GGTNACC	1 cut(s)	92
EcoRII	CCWGG	1 cut(s)	188
EcoT14I	CCWWGG	1 cut(s)	222
ErhI	CCWWGG	1 cut(s)	222
FaiI	YATR	3 cut(s)	33, 216, 218
FokI	GGATG	1 cut(s)	254
FspBI	CTAG	4 cut(s)	98, 165, 230, 276
HinfI	GANTC	1 cut(s)	80
HphI	GGTGA	1 cut(s)	104
Hpy188I	TCNGA	4 cut(s)	24, 85, 114, 157
HpyCH4III	ACNGT	2 cut(s)	16, 92
HpyF10VI	GCNNNNNNNGC	1 cut(s)	170
Kzo9I	GATC	2 cut(s)	109, 253
LpnPI	CCDG	2 cut(s)	175, 202
MaeI	CTAG	4 cut(s)	98, 165, 230, 276
MaeIII	GTNAC	1 cut(s)	92
MalI	GATC	2 cut(s)	111, 255
MboI	GATC	2 cut(s)	109, 253
MboII	GAAGA	1 cut(s)	170
MluCI	AATT	1 cut(s)	249
MnlI	CCTC	5 cut(s)	57, 65, 108, 117, 154
MseI	TTAA	2 cut(s)	60, 129
MspCI	CTTAAG	2 cut(s)	59, 128
MspR9I	CCNGG	1 cut(s)	190
MvaI	CCWGG	1 cut(s)	190
MwoI	GCNNNNNNNGC	1 cut(s)	170
NdeII	GATC	2 cut(s)	109, 253
NmuCI	GTSAC	1 cut(s)	92
PfeI	GAWTC	1 cut(s)	80
Psp6I	CCWGG	1 cut(s)	188
PspEI	GGTNACC	1 cut(s)	92
PspGI	CCWGG	1 cut(s)	188
SaqAI	TTAA	2 cut(s)	60, 129
Sau3AI	GATC	2 cut(s)	109, 253
ScrFI	CCNGG	1 cut(s)	190
SetI	ASST	4 cut(s)	48, 99, 135, 194
SgeI	CNNG	9 cut(s)	59, 83, 110, 177, 201, 202, 235, 242, 248
SmlI	CTYRAG	2 cut(s)	59, 128
SmoI	CTYRAG	2 cut(s)	59, 128
Sse9I	AATT	1 cut(s)	249
SspMI	CTAG	4 cut(s)	98, 165, 230, 276
StyD4I	CCNGG	1 cut(s)	188
StyI	CCWWGG	1 cut(s)	222
TaaI	ACNGT	2 cut(s)	16, 92
TaqI	TCGA	1 cut(s)	256
TasI	AATT	1 cut(s)	249
TfiI	GAWTC	1 cut(s)	80
Tru1I	TTAA	2 cut(s)	60, 129
Tru9I	TTAA	2 cut(s)	60, 129
TseFI	GTSAC	1 cut(s)	92
Tsp45I	GTSAC	1 cut(s)	92
TspDTI	ATGAA	2 cut(s)	195, 261
Vha464I	CTTAAG	2 cut(s)	59, 128
XspI	CTAG	4 cut(s)	98, 165, 230, 276

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.