Rmu_sc0001790.1_g000004

Glycine-rich cell wall structural protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001790.1
Physical Location & Seq
Forward (+)
15817 .. 16440
624 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001790.1_g000004.1.cds

Sequence Viewer

Length: 624 bp
atggccaacactaaggtaattggtgctgcattcttgatattgctccttgtggagctatcctttgcggctagatcattaaaggccattaaagctagtggcggccgtggtggtggtagcggtggcggtggaggtggaggaggaggagggggtgggtcaacatctggctcaggctctgggtatggttcgggaaaaggttcagggagtggttcggggtatggtagtaatggaggaggaggtggtggtggaggcgaaggtggagggggaggtggcggtggtggaacgggtttacatggtggttctgggtcaggatatgggtcaggatatggctccggatatggatcaggggaaggaattggaaaaggtggaggaggggggggaggaggtggtggtggcggaggaggtggtggtggtggaggcactggaaatggtgggtctggttatgggtcgggatatggaagtggaagtggatatgggagtggaggtggcaaaggtgggggtggtggtggaggtggaggaggcggcggcggcggaggtggtggtggtaatggtagtggtagcgggtctggttatgggtcaggctcaggctatggcagtggaggtggagattattgggattcaccatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

207

Amino Acids

16.56

Weight (kDa)

9.13

Isoelectric Point (pI)

38.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019259)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g06591
prunus_persica Prupe.2G093800_v2.0.a1
pyrus_communis pycom02g20880
rosa_chinensis RchiOBHm_Chr1g0335261
rosa_laevigata RLG00000029391
rosa_multiflora Rmu_sc0001790.1_g000004
rosa_roxburghii Rroxscaffold_4G00316110
rosa_samantha Rh1BG111900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 329
AclWI GGATC 1 cut(s) 346
AcoI YGGCCR 2 cut(s) 3, 100
AluBI AGCT 2 cut(s) 55, 92
AluI AGCT 2 cut(s) 55, 92
AlwI GGATC 1 cut(s) 346
AlwNI CAGNNNCTG 1 cut(s) 173
Aor13HI TCCGGA 1 cut(s) 329
AoxI GGCC 3 cut(s) 3, 81, 100
ApeKI GCWGC 1 cut(s) 26
Asp700I GAANNNNTTC 1 cut(s) 193
AsuHPI GGTGA 1 cut(s) 609
BalI TGGCCA 1 cut(s) 5
BbvI GCAGC 1 cut(s) 13
BceAI ACGGC 1 cut(s) 87
BfaI CTAG 2 cut(s) 69, 93
BisI GCNGC 6 cut(s) 27, 66, 100, 520, 523, 526
BlsI GCNGC 6 cut(s) 28, 67, 101, 521, 524, 527
BmiI GGNNCC 1 cut(s) 328
Bpu10I CCTNAGC 2 cut(s) 166, 580
BsaBI GATNNNNATC 1 cut(s) 337
BsaJI CCNNGG 1 cut(s) 103
BsaWI WCCGGW 1 cut(s) 329
BsaXI ACNNNNNCTCC 2 cut(s) 466, 496
Bse1I ACTGG 1 cut(s) 424
Bse8I GATNNNNATC 1 cut(s) 337
BseAI TCCGGA 1 cut(s) 329
BseDI CCNNGG 1 cut(s) 103
BseJI GATNNNNATC 1 cut(s) 337
BseMII CTCAG 2 cut(s) 180, 594
BseNI ACTGG 1 cut(s) 424
BseRI GAGGAG 9 cut(s) 150, 153, 156, 243, 246, 381, 393, 411, 528
BseX3I CGGCCG 1 cut(s) 100
BseXI GCAGC 1 cut(s) 13
Bsh1285I CGRYCG 1 cut(s) 103
BshFI GGCC 3 cut(s) 5, 83, 102
BsiEI CGRYCG 1 cut(s) 103
BsiSI CCGG 1 cut(s) 330
BsmI GAATGC 1 cut(s) 29
BsnI GGCC 3 cut(s) 5, 83, 102
Bsp13I TCCGGA 1 cut(s) 329
Bsp143I GATC 2 cut(s) 71, 338
BspANI GGCC 3 cut(s) 5, 83, 102
BspCNI CTCAG 2 cut(s) 179, 593
BspEI TCCGGA 1 cut(s) 329
BspLI GGNNCC 1 cut(s) 328
BspPI GGATC 1 cut(s) 346
BsrI ACTGG 1 cut(s) 424
BssECI CCNNGG 1 cut(s) 103
BssMI GATC 2 cut(s) 71, 338
BstDEI CTNAG 3 cut(s) 12, 166, 580
BstDSI CCRYGG 1 cut(s) 103
BstKTI GATC 2 cut(s) 74, 341
BstMBI GATC 2 cut(s) 71, 338
BstMCI CGRYCG 1 cut(s) 103
BstMWI GCNNNNNNNGC 2 cut(s) 89, 525
BstV1I GCAGC 1 cut(s) 13
BstZI CGGCCG 1 cut(s) 100
BsuRI GGCC 3 cut(s) 5, 83, 102
BtgI CCRYGG 1 cut(s) 103
BtsI GCAGTG 1 cut(s) 598
BtsIMutI CAGTG 2 cut(s) 417, 598
CaiI CAGNNNCTG 1 cut(s) 173
CviAII CATG 2 cut(s) 290, 621
DdeI CTNAG 3 cut(s) 12, 166, 580
DpnI GATC 2 cut(s) 73, 340
DpnII GATC 2 cut(s) 71, 338
EaeI YGGCCR 2 cut(s) 3, 100
EagI CGGCCG 1 cut(s) 100
EciI GGCGGA 2 cut(s) 408, 543
EclXI CGGCCG 1 cut(s) 100
Eco52I CGGCCG 1 cut(s) 100
FaeI CATG 2 cut(s) 293, 624
FatI CATG 2 cut(s) 289, 620
FauI CCCGC 1 cut(s) 551
Fnu4HI GCNGC 6 cut(s) 27, 66, 100, 520, 523, 526
Fsp4HI GCNGC 6 cut(s) 27, 66, 100, 520, 523, 526
FspBI CTAG 2 cut(s) 69, 93
GluI GCNGC 6 cut(s) 27, 66, 100, 520, 523, 526
HaeIII GGCC 3 cut(s) 5, 83, 102
HapII CCGG 1 cut(s) 330
Hin1II CATG 2 cut(s) 293, 624
HincII GTYRAC 1 cut(s) 156
HindII GTYRAC 1 cut(s) 156
HinfI GANTC 1 cut(s) 614
HpaII CCGG 1 cut(s) 330
HphI GGTGA 1 cut(s) 609
Hpy166II GTNNAC 2 cut(s) 156, 287
Hpy188III TCNNGA 6 cut(s) 34, 186, 306, 318, 330, 447
Hpy8I GTNNAC 2 cut(s) 156, 287
HpyAV CCTTC 2 cut(s) 245, 341
HpyCH4V TGCA 1 cut(s) 29
HpyF10VI GCNNNNNNNGC 2 cut(s) 89, 525
HpyF3I CTNAG 3 cut(s) 12, 166, 580
Hsp92II CATG 2 cut(s) 293, 624
Kpn2I TCCGGA 1 cut(s) 329
Kzo9I GATC 2 cut(s) 71, 338
LmnI GCTCC 3 cut(s) 48, 52, 332
Lsp1109I GCAGC 1 cut(s) 13
MaeI CTAG 2 cut(s) 69, 93
MalI GATC 2 cut(s) 73, 340
MboI GATC 2 cut(s) 71, 338
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 18, 351
MluNI TGGCCA 1 cut(s) 5
Mox20I TGGCCA 1 cut(s) 5
MroI TCCGGA 1 cut(s) 329
MroXI GAANNNNTTC 1 cut(s) 193
MscI TGGCCA 1 cut(s) 5
MseI TTAA 2 cut(s) 77, 87
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 1 cut(s) 330
Mva1269I GAATGC 1 cut(s) 29
MwoI GCNNNNNNNGC 2 cut(s) 89, 525
NdeII GATC 2 cut(s) 71, 338
NlaIII CATG 2 cut(s) 293, 624
NlaIV GGNNCC 1 cut(s) 328
PctI GAATGC 1 cut(s) 29
PdmI GAANNNNTTC 1 cut(s) 193
PfeI GAWTC 1 cut(s) 614
PkrI GCNGC 6 cut(s) 28, 67, 101, 521, 524, 527
PspN4I GGNNCC 1 cut(s) 328
PstNI CAGNNNCTG 1 cut(s) 173
SaqAI TTAA 2 cut(s) 77, 87
SatI GCNGC 6 cut(s) 27, 66, 100, 520, 523, 526
Sau3AI GATC 2 cut(s) 71, 338
Sse9I AATT 2 cut(s) 18, 351
SspMI CTAG 2 cut(s) 69, 93
TasI AATT 2 cut(s) 18, 351
TauI GCSGC 5 cut(s) 68, 102, 522, 525, 528
TfiI GAWTC 1 cut(s) 614
Tru1I TTAA 2 cut(s) 77, 87
Tru9I TTAA 2 cut(s) 77, 87
TscAI CASTG 2 cut(s) 424, 598
TseI GCWGC 1 cut(s) 26
TspRI CASTG 2 cut(s) 424, 598
XmnI GAANNNNTTC 1 cut(s) 193
XspI CTAG 2 cut(s) 69, 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.