Rmu_sc0001917.1_g000003

PDDEXK-like family of unknown function

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001917.1
OG0018361
Physical Location & Seq
Reverse (-)
13610 .. 19541
5932 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001917.1_g000003.1.cds

Sequence Viewer

Length: 1071 bp
atgagggtgttttccacttgggagacccctccttctagctctaaatgtttctgtgtgagaacgggttatcatgagagcttccatctccggattctgtacctgccaaccatgaacagaggtcaggctgttaaggttgtccatgtgaaacaaggtgccaataatgttgcgcatctcatattagctcatgcatgctgcaagaactgttgcaacgacacatctagggaaggctcttggagggacaatatcatcatcatcatcatcatggacagccttgaagagagagtttctgtgttttaccatgaaaattccgatgaatatgatcataattcctccgattatgaattcgatgatgacgctggcgattctgatgccaaacgacagaggatcttgtactgggaatcacaacaagctttgcttcaggagattttagaacgaagcagattaaccggatcaaagttgcggcaagaggttcgcgaaatcacagagaaagcgagatcagagcaaagagatttgtgtcgatgccacaaacctaatgttgatgcatgcaacaactgcttgcgacatggaatcgtcaactcgctttgcgataaaggatttaaagcctctctatgcatatcaaaatggtccgaaaccaaaaaaattccaggagggactcatgagtacatcgaagtcactggaaacacgtccacaagccgaacaaagcaacttttctatgtagttgaactggaatttggtgatcaattcgagattgcaaaagcatgcaatgagtaccgaaatctcgtaaggatgttaccacaaacttatgtaggaaaagctgactacctcaaggccattgttcgaattgtatgcgatgcagccaagcgatcaatgaaggaaagcagaatgcatatgggtccgtggcgaaagagaggcttcatgctaatgaaatggtcggcttccattgagaggttggcttctgttgaatcggtatcaacatcaaatagatataacgtgcaatcattactttcatcagagagagcgcatgcatcatcttatagatactttgcagctccaactgtagtagtcacgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PDDEXK_6

Protein Analysis

356

Amino Acids

40.9

Weight (kDa)

8.67

Isoelectric Point (pI)

49.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018361)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g25290
rosa_chinensis RchiOBHm_Chr2g0123301
rosa_multiflora Rmu_sc0001917.1_g000003
rosa_roxburghii Rroxscaffold_2G00120790
rosa_rugosa Rorug02G0244300 Rorug02G0244400
rosa_samantha Rh2AG303500 Rh2CG290100 Rh2DG327500
rosa_wichuraiana Rw2G024290

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 168
Acc36I ACCTGC 1 cut(s) 108
AccB1I GGYRCC 1 cut(s) 152
AccII CGCG 1 cut(s) 474
AccIII TCCGGA 1 cut(s) 87
AciI CCGC 1 cut(s) 460
AclWI GGATC 2 cut(s) 392, 457
AcsI RAATTY 4 cut(s) 304, 341, 639, 728
AcuI CTGAAG 1 cut(s) 401
AfaI GTAC 4 cut(s) 98, 392, 662, 770
AfiI CCNNNNNNNGG 1 cut(s) 945
AflIII ACRYGT 1 cut(s) 681
AgsI TTSAA 3 cut(s) 275, 722, 962
AjiI CACGTC 1 cut(s) 684
AjnI CCWGG 1 cut(s) 643
AjuI GAANNNNNNNTTGG 2 cut(s) 714, 746
AluBI AGCT 6 cut(s) 39, 78, 182, 410, 815, 1049
AluI AGCT 6 cut(s) 39, 78, 182, 410, 815, 1049
Alw26I GTCTC 1 cut(s) 17
AlwI GGATC 2 cut(s) 392, 457
Aor13HI TCCGGA 1 cut(s) 87
AoxI GGCC 1 cut(s) 828
ApeKI GCWGC 3 cut(s) 192, 854, 1046
ApoI RAATTY 4 cut(s) 304, 341, 639, 728
AspLEI GCGC 2 cut(s) 169, 1021
AspS9I GGNCC 2 cut(s) 624, 893
AsuHPI GGTGA 1 cut(s) 746
AsuII TTCGAA 1 cut(s) 838
AvaII GGWCC 2 cut(s) 624, 893
BanI GGYRCC 1 cut(s) 152
BbvI GCAGC 3 cut(s) 179, 866, 1058
BccI CCATC 1 cut(s) 90
BcgI CGANNNNNNTGC 6 cut(s) 350, 384, 452, 486, 828, 862
BciT130I CCWGG 1 cut(s) 645
BclI TGATCA 2 cut(s) 319, 736
BcoDI GTCTC 1 cut(s) 17
BfaI CTAG 2 cut(s) 36, 219
BfmI CTRYAG 1 cut(s) 1056
BfuAI ACCTGC 1 cut(s) 108
BisI GCNGC 4 cut(s) 193, 461, 855, 1047
BlsI GCNGC 4 cut(s) 194, 462, 856, 1048
Bme1390I CCNGG 1 cut(s) 645
Bme18I GGWCC 2 cut(s) 624, 893
BmgBI CACGTC 1 cut(s) 684
BmgT120I GGNCC 2 cut(s) 624, 893
BmiI GGNNCC 2 cut(s) 154, 894
BmrFI CCNGG 1 cut(s) 645
BmrI ACTGGG 1 cut(s) 403
BmsI GCATC 6 cut(s) 178, 358, 509, 529, 841, 1034
BmuI ACTGGG 1 cut(s) 403
Bpu14I TTCGAA 1 cut(s) 838
BpuEI CTTGAG 1 cut(s) 809
BsaAI YACGTR 1 cut(s) 1068
BsaI GGTCTC 1 cut(s) 17
BsaJI CCNNGG 1 cut(s) 896
BsaWI WCCGGW 2 cut(s) 87, 446
Bsc4I CCNNNNNNNGG 1 cut(s) 945
Bse1I ACTGG 3 cut(s) 398, 679, 729
Bse3DI GCAATG 1 cut(s) 769
BseAI TCCGGA 1 cut(s) 87
BseBI CCWGG 1 cut(s) 645
BseDI CCNNGG 1 cut(s) 896
BseGI GGATG 1 cut(s) 792
BseLI CCNNNNNNNGG 1 cut(s) 945
BseMI GCAATG 1 cut(s) 769
BseNI ACTGG 3 cut(s) 398, 679, 729
BseXI GCAGC 3 cut(s) 179, 866, 1058
Bsh1236I CGCG 1 cut(s) 474
BshFI GGCC 1 cut(s) 830
BshNI GGYRCC 1 cut(s) 152
BsiSI CCGG 2 cut(s) 88, 447
BslFI GGGAC 2 cut(s) 251, 664
BslI CCNNNNNNNGG 1 cut(s) 945
BsmAI GTCTC 1 cut(s) 17
BsmFI GGGAC 2 cut(s) 251, 664
BsmI GAATGC 1 cut(s) 888
BsnI GGCC 1 cut(s) 830
Bso31I GGTCTC 1 cut(s) 17
Bsp119I TTCGAA 1 cut(s) 838
Bsp13I TCCGGA 1 cut(s) 87
Bsp143I GATC 6 cut(s) 319, 384, 449, 494, 736, 863
Bsp68I TCGCGA 1 cut(s) 474
BspACI CCGC 1 cut(s) 460
BspANI GGCC 1 cut(s) 830
BspEI TCCGGA 1 cut(s) 87
BspFNI CGCG 1 cut(s) 474
BspHI TCATGA 2 cut(s) 70, 655
BspLI GGNNCC 2 cut(s) 154, 894
BspMI ACCTGC 1 cut(s) 108
BspPI GGATC 2 cut(s) 392, 457
BspT104I TTCGAA 1 cut(s) 838
BspT107I GGYRCC 1 cut(s) 152
BspTNI GGTCTC 1 cut(s) 17
BsrDI GCAATG 1 cut(s) 769
BsrI ACTGG 3 cut(s) 398, 679, 729
BssECI CCNNGG 1 cut(s) 896
BssMI GATC 6 cut(s) 319, 384, 449, 494, 736, 863
Bst2UI CCWGG 1 cut(s) 645
Bst4CI ACNGT 2 cut(s) 203, 1057
Bst6I CTCTTC 1 cut(s) 270
BstAPI GCANNNNNTGC 1 cut(s) 552
BstBAI YACGTR 1 cut(s) 1068
BstBI TTCGAA 1 cut(s) 838
BstC8I GCNNGC 6 cut(s) 190, 358, 544, 557, 760, 1023
BstDSI CCRYGG 1 cut(s) 896
BstF5I GGATG 1 cut(s) 792
BstFNI CGCG 1 cut(s) 474
BstHHI GCGC 2 cut(s) 169, 1021
BstKTI GATC 6 cut(s) 322, 387, 452, 497, 739, 866
BstMAI GTCTC 1 cut(s) 17
BstMBI GATC 6 cut(s) 319, 384, 449, 494, 736, 863
BstMWI GCNNNNNNNGC 1 cut(s) 552
BstNI CCWGG 1 cut(s) 645
BstNSI RCATGY 4 cut(s) 192, 546, 762, 1025
BstSCI CCNGG 1 cut(s) 643
BstSFI CTRYAG 1 cut(s) 1056
BstUI CGCG 1 cut(s) 474
BstV1I GCAGC 3 cut(s) 179, 866, 1058
BstX2I RGATCY 1 cut(s) 384
BstYI RGATCY 1 cut(s) 384
BsuRI GGCC 1 cut(s) 830
BtgI CCRYGG 1 cut(s) 896
BtgZI GCGATG 1 cut(s) 864
BtrI CACGTC 1 cut(s) 684
BtsCI GGATG 1 cut(s) 792
BtsIMutI CAGTG 1 cut(s) 672
BtuMI TCGCGA 1 cut(s) 474
BveI ACCTGC 1 cut(s) 108
Cac8I GCNNGC 6 cut(s) 190, 358, 544, 557, 760, 1023
CciI TCATGA 2 cut(s) 70, 655
CfoI GCGC 2 cut(s) 169, 1021
Cfr13I GGNCC 2 cut(s) 624, 893
CseI GACGC 1 cut(s) 362
Csp6I GTAC 4 cut(s) 97, 391, 661, 769
CviQI GTAC 4 cut(s) 97, 391, 661, 769
DpnI GATC 6 cut(s) 321, 386, 451, 496, 738, 865
DpnII GATC 6 cut(s) 319, 384, 449, 494, 736, 863
DraI TTTAAA 1 cut(s) 598
Eam1104I CTCTTC 1 cut(s) 270
EarI CTCTTC 1 cut(s) 270
Eco31I GGTCTC 1 cut(s) 17
Eco47I GGWCC 2 cut(s) 624, 893
Eco57I CTGAAG 1 cut(s) 401
EcoRI GAATTC 1 cut(s) 341
EcoRII CCWGG 1 cut(s) 643
EcoT22I ATGCAT 5 cut(s) 190, 544, 614, 888, 1027
FalI AAGNNNNNCTT 4 cut(s) 399, 431, 896, 928
FaqI GGGAC 2 cut(s) 251, 664
FauNDI CATATG 1 cut(s) 888
FbaI TGATCA 2 cut(s) 319, 736
Fnu4HI GCNGC 4 cut(s) 193, 461, 855, 1047
FokI GGATG 1 cut(s) 799
Fsp4HI GCNGC 4 cut(s) 193, 461, 855, 1047
FspBI CTAG 2 cut(s) 36, 219
FspI TGCGCA 1 cut(s) 168
GlaI GCGC 2 cut(s) 168, 1020
GluI GCNGC 4 cut(s) 193, 461, 855, 1047
HaeIII GGCC 1 cut(s) 830
HapII CCGG 2 cut(s) 88, 447
HgaI GACGC 1 cut(s) 362
HhaI GCGC 2 cut(s) 169, 1021
Hin6I GCGC 2 cut(s) 167, 1019
HinP1I GCGC 2 cut(s) 167, 1019
HincII GTYRAC 1 cut(s) 574
HindII GTYRAC 1 cut(s) 574
HindIII AAGCTT 1 cut(s) 408
HinfI GANTC 6 cut(s) 91, 362, 398, 567, 652, 962
HpaII CCGG 2 cut(s) 88, 447
HphI GGTGA 1 cut(s) 746
Hpy166II GTNNAC 2 cut(s) 574, 687
Hpy188I TCNGA 6 cut(s) 310, 334, 367, 499, 628, 1012
Hpy188III TCNNGA 6 cut(s) 71, 88, 419, 473, 656, 745
Hpy8I GTNNAC 2 cut(s) 574, 687
HpyAV CCTTC 3 cut(s) 42, 218, 865
HpyCH4III ACNGT 2 cut(s) 203, 1057
HpyCH4IV ACGT 3 cut(s) 683, 990, 1067
HpyF10VI GCNNNNNNNGC 1 cut(s) 552
HpySE526I ACGT 3 cut(s) 683, 990, 1067
HspAI GCGC 2 cut(s) 167, 1019
Kpn2I TCCGGA 1 cut(s) 87
Ksp22I TGATCA 2 cut(s) 319, 736
Kzo9I GATC 6 cut(s) 319, 384, 449, 494, 736, 863
LmnI GCTCC 1 cut(s) 1054
Lsp1109I GCAGC 3 cut(s) 179, 866, 1058
LweI GCATC 6 cut(s) 178, 358, 509, 529, 841, 1034
MaeI CTAG 2 cut(s) 36, 219
MaeII ACGT 3 cut(s) 683, 990, 1067
MaeIII GTNAC 3 cut(s) 670, 789, 1063
MalI GATC 6 cut(s) 321, 386, 451, 496, 738, 865
MboI GATC 6 cut(s) 319, 384, 449, 494, 736, 863
MboII GAAGA 1 cut(s) 287
MflI RGATCY 1 cut(s) 384
MluCI AATT 7 cut(s) 304, 325, 341, 639, 728, 740, 840
MlyI GAGTC 1 cut(s) 646
Mph1103I ATGCAT 5 cut(s) 190, 544, 614, 888, 1027
MroI TCCGGA 1 cut(s) 87
MseI TTAA 3 cut(s) 129, 443, 597
MslI CAYNNNNRTG 2 cut(s) 260, 920
MspI CCGG 2 cut(s) 88, 447
MspR9I CCNGG 1 cut(s) 645
Mva1269I GAATGC 1 cut(s) 888
MvaI CCWGG 1 cut(s) 645
MvnI CGCG 1 cut(s) 474
MwoI GCNNNNNNNGC 1 cut(s) 552
NdeI CATATG 1 cut(s) 888
NdeII GATC 6 cut(s) 319, 384, 449, 494, 736, 863
NlaIV GGNNCC 2 cut(s) 154, 894
NmuCI GTSAC 2 cut(s) 670, 1063
NruI TCGCGA 1 cut(s) 474
NsbI TGCGCA 1 cut(s) 168
NsiI ATGCAT 5 cut(s) 190, 544, 614, 888, 1027
NspI RCATGY 4 cut(s) 192, 546, 762, 1025
NspV TTCGAA 1 cut(s) 838
PaeI GCATGC 4 cut(s) 192, 546, 762, 1025
PagI TCATGA 2 cut(s) 70, 655
PctI GAATGC 1 cut(s) 888
PfeI GAWTC 5 cut(s) 91, 362, 398, 567, 962
PfoI TCCNGGA 1 cut(s) 643
PkrI GCNGC 4 cut(s) 194, 462, 856, 1048
PleI GAGTC 1 cut(s) 646
PpsI GAGTC 1 cut(s) 646
Ppu21I YACGTR 1 cut(s) 1068
Psp6I CCWGG 1 cut(s) 643
PspGI CCWGG 1 cut(s) 643
PspN4I GGNNCC 2 cut(s) 154, 894
PspPI GGNCC 2 cut(s) 624, 893
PsuI RGATCY 1 cut(s) 384
RruI TCGCGA 1 cut(s) 474
RsaI GTAC 4 cut(s) 98, 392, 662, 770
RsaNI GTAC 4 cut(s) 97, 391, 661, 769
RseI CAYNNNNRTG 2 cut(s) 260, 920
SaqAI TTAA 3 cut(s) 129, 443, 597
SatI GCNGC 4 cut(s) 193, 461, 855, 1047
Sau3AI GATC 6 cut(s) 319, 384, 449, 494, 736, 863
Sau96I GGNCC 2 cut(s) 624, 893
SchI GAGTC 1 cut(s) 646
ScrFI CCNGG 1 cut(s) 645
SfaNI GCATC 6 cut(s) 178, 358, 509, 529, 841, 1034
SfcI CTRYAG 1 cut(s) 1056
SfuI TTCGAA 1 cut(s) 838
SinI GGWCC 2 cut(s) 624, 893
SmiMI CAYNNNNRTG 2 cut(s) 260, 920
SmlI CTYRAG 1 cut(s) 824
SmoI CTYRAG 1 cut(s) 824
SphI GCATGC 4 cut(s) 192, 546, 762, 1025
Sse9I AATT 7 cut(s) 304, 325, 341, 639, 728, 740, 840
SsiI CCGC 1 cut(s) 460
SspMI CTAG 2 cut(s) 36, 219
StyD4I CCNGG 1 cut(s) 643
TaaI ACNGT 2 cut(s) 203, 1057
TaiI ACGT 3 cut(s) 686, 993, 1070
TaqI TCGA 5 cut(s) 345, 517, 666, 744, 838
TasI AATT 7 cut(s) 304, 325, 341, 639, 728, 740, 840
TatI WGTACW 2 cut(s) 390, 660
TauI GCSGC 1 cut(s) 463
TfiI GAWTC 5 cut(s) 91, 362, 398, 567, 962
Tru1I TTAA 3 cut(s) 129, 443, 597
Tru9I TTAA 3 cut(s) 129, 443, 597
TscAI CASTG 1 cut(s) 679
TseFI GTSAC 2 cut(s) 670, 1063
TseI GCWGC 3 cut(s) 192, 854, 1046
Tsp45I GTSAC 2 cut(s) 670, 1063
TspDTI ATGAA 8 cut(s) 125, 315, 327, 354, 884, 904, 938, 996
TspGWI ACGGA 1 cut(s) 885
TspRI CASTG 1 cut(s) 679
VpaK11BI GGWCC 2 cut(s) 624, 893
XapI RAATTY 4 cut(s) 304, 341, 639, 728
XceI RCATGY 4 cut(s) 192, 546, 762, 1025
XcmI CCANNNNNNNNNTGG 1 cut(s) 946
XspI CTAG 2 cut(s) 36, 219
Zsp2I ATGCAT 5 cut(s) 190, 544, 614, 888, 1027
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.