Rmu_sc0002031.1_g000008

U4 U6 small nuclear ribonucleoprotein PRP4-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002031.1
Physical Location & Seq
Forward (+)
33052 .. 33393
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002031.1_g000008.1.cds

Sequence Viewer

Length: 342 bp
atgggatttaccgatttaagaataaggaattccatatacattgttggacactccaagcccatatcacaggtcgagtttgagactcaagatggacacttcttggtaactggttcgtatgttactacagcaaagatatggtcagctcgagaatttaaggttgtgaggacactcgtccgagtctccagacatgaagcgaaagttgcttctttggatgtttcaggagatggttatcacattgctactgtttcacatgtcccaaccgttaaactatggtcccgcagaaccaataaggaccaggatgtaggacaggctgaattttcagaagaccaggcttcgacttaa

Protein Analysis

113

Amino Acids

12.68

Weight (kDa)

8.1

Isoelectric Point (pI)

28.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020449)

Species Orthologous Gene IDs
pyrus_communis pycom14g06980
rosa_laevigata RLG00000024680
rosa_multiflora Rmu_sc0002031.1_g000008 Rmu_sc0014550.1_g000012
rosa_samantha Rh3BG135500 Rh3DG137100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 277
AcsI RAATTY 3 cut(s) 28, 149, 314
AflIII ACRYGT 1 cut(s) 250
AjnI CCWGG 2 cut(s) 294, 327
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
Alw26I GTCTC 2 cut(s) 74, 184
Ama87I CYCGRG 1 cut(s) 144
ApoI RAATTY 3 cut(s) 28, 149, 314
ArsI GACNNNNNNTTYG 2 cut(s) 122, 154
AspS9I GGNCC 2 cut(s) 273, 292
AvaI CYCGRG 1 cut(s) 144
AvaII GGWCC 2 cut(s) 273, 292
BbsI GAAGAC 1 cut(s) 330
BccI CCATC 2 cut(s) 83, 218
BciT130I CCWGG 2 cut(s) 296, 329
BcoDI GTCTC 2 cut(s) 74, 184
BfmI CTRYAG 1 cut(s) 123
Bme1390I CCNGG 2 cut(s) 296, 329
Bme18I GGWCC 2 cut(s) 273, 292
BmeT110I CYCGRG 1 cut(s) 144
BmgT120I GGNCC 2 cut(s) 273, 292
BmiI GGNNCC 1 cut(s) 275
BmrFI CCNGG 2 cut(s) 296, 329
BoxI GACNNNNGTC 1 cut(s) 170
BpiI GAAGAC 1 cut(s) 330
BpmI CTGGAG 1 cut(s) 166
BpuEI CTTGAG 1 cut(s) 69
BsaBI GATNNNNATC 1 cut(s) 228
Bse1I ACTGG 1 cut(s) 112
Bse3DI GCAATG 1 cut(s) 234
Bse8I GATNNNNATC 1 cut(s) 228
BseBI CCWGG 2 cut(s) 296, 329
BseGI GGATG 2 cut(s) 217, 304
BseJI GATNNNNATC 1 cut(s) 228
BseMI GCAATG 1 cut(s) 234
BseNI ACTGG 1 cut(s) 112
BsiHKCI CYCGRG 1 cut(s) 144
BslFI GGGAC 2 cut(s) 239, 259
BsmAI GTCTC 2 cut(s) 74, 184
BsmFI GGGAC 2 cut(s) 239, 259
BsoBI CYCGRG 1 cut(s) 144
BspACI CCGC 1 cut(s) 277
BspLI GGNNCC 1 cut(s) 275
BsrDI GCAATG 1 cut(s) 234
BsrI ACTGG 1 cut(s) 112
Bst2UI CCWGG 2 cut(s) 296, 329
Bst4CI ACNGT 2 cut(s) 244, 262
BstF5I GGATG 2 cut(s) 217, 304
BstMAI GTCTC 2 cut(s) 74, 184
BstMWI GCNNNNNNNGC 1 cut(s) 200
BstNI CCWGG 2 cut(s) 296, 329
BstNSI RCATGY 1 cut(s) 254
BstPAI GACNNNNGTC 1 cut(s) 170
BstSCI CCNGG 2 cut(s) 294, 327
BstSFI CTRYAG 1 cut(s) 123
BstV2I GAAGAC 1 cut(s) 330
BtsCI GGATG 2 cut(s) 217, 304
Cfr13I GGNCC 2 cut(s) 273, 292
CviAII CATG 2 cut(s) 188, 251
CviJI RGCY 4 cut(s) 58, 143, 311, 332
CviKI_1 RGCY 4 cut(s) 58, 143, 311, 332
Eco47I GGWCC 2 cut(s) 273, 292
Eco88I CYCGRG 1 cut(s) 144
EcoRI GAATTC 1 cut(s) 28
EcoRII CCWGG 2 cut(s) 294, 327
FaeI CATG 2 cut(s) 191, 254
FaiI YATR 8 cut(s) 35, 37, 62, 117, 136, 189, 252, 271
FaqI GGGAC 2 cut(s) 239, 259
FatI CATG 2 cut(s) 187, 250
FauI CCCGC 1 cut(s) 284
FokI GGATG 2 cut(s) 224, 311
GsuI CTGGAG 1 cut(s) 166
Hin1II CATG 2 cut(s) 191, 254
HinfI GANTC 2 cut(s) 82, 177
Hpy188I TCNGA 2 cut(s) 176, 322
Hpy188III TCNNGA 4 cut(s) 86, 146, 183, 219
HpyCH4III ACNGT 2 cut(s) 244, 262
HpyF10VI GCNNNNNNNGC 1 cut(s) 200
Hsp92II CATG 2 cut(s) 191, 254
LpnPI CCDG 8 cut(s) 53, 93, 196, 204, 281, 293, 308, 314
MaeIII GTNAC 2 cut(s) 103, 118
MboII GAAGA 1 cut(s) 335
MluCI AATT 3 cut(s) 28, 149, 314
MlyI GAGTC 2 cut(s) 76, 186
MmeI TCCRAC 1 cut(s) 25
MnlI CCTC 1 cut(s) 156
MseI TTAA 4 cut(s) 17, 153, 264, 340
MspR9I CCNGG 2 cut(s) 296, 329
MvaI CCWGG 2 cut(s) 296, 329
MwoI GCNNNNNNNGC 1 cut(s) 200
NlaIII CATG 2 cut(s) 191, 254
NlaIV GGNNCC 1 cut(s) 275
NspI RCATGY 1 cut(s) 254
PaeR7I CTCGAG 1 cut(s) 144
PciI ACATGT 1 cut(s) 250
PleI GAGTC 2 cut(s) 76, 185
PpsI GAGTC 2 cut(s) 76, 185
PscI ACATGT 1 cut(s) 250
PshAI GACNNNNGTC 1 cut(s) 170
Psp6I CCWGG 2 cut(s) 294, 327
PspGI CCWGG 2 cut(s) 294, 327
PspN4I GGNNCC 1 cut(s) 275
PspPI GGNCC 2 cut(s) 273, 292
SaqAI TTAA 4 cut(s) 17, 153, 264, 340
Sau96I GGNCC 2 cut(s) 273, 292
SchI GAGTC 2 cut(s) 76, 186
ScrFI CCNGG 2 cut(s) 296, 329
SetI ASST 3 cut(s) 72, 145, 159
SfcI CTRYAG 1 cut(s) 123
Sfr274I CTCGAG 1 cut(s) 144
SinI GGWCC 2 cut(s) 273, 292
SlaI CTCGAG 1 cut(s) 144
SmlI CTYRAG 2 cut(s) 84, 144
SmoI CTYRAG 2 cut(s) 84, 144
Sse9I AATT 3 cut(s) 28, 149, 314
SsiI CCGC 1 cut(s) 277
StyD4I CCNGG 2 cut(s) 294, 327
TaaI ACNGT 2 cut(s) 244, 262
TaqI TCGA 3 cut(s) 72, 145, 335
TasI AATT 3 cut(s) 28, 149, 314
Tru1I TTAA 4 cut(s) 17, 153, 264, 340
Tru9I TTAA 4 cut(s) 17, 153, 264, 340
TspDTI ATGAA 1 cut(s) 204
VpaK11BI GGWCC 2 cut(s) 273, 292
XapI RAATTY 3 cut(s) 28, 149, 314
XceI RCATGY 1 cut(s) 254
XhoI CTCGAG 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.