Rmu_sc0014550.1_g000012

U4 U6 small nuclear ribonucleoprotein PRP4-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014550.1
Physical Location & Seq
Reverse (-)
20658 .. 20996
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014550.1_g000012.1.cds

Sequence Viewer

Length: 339 bp
atgggatttaccgatttaagcataaggaattccatatacattgttggacactccaagtccatatcacaggtcgagtttgagactcaagatggacacttcttggtaactgcttcgtatgttactacagcaaagataaggtcagcccgagaatttaaggttgtgaggacactcgtccgagtctccagacatgaagcgaaagttgcttctttggatgtttcaggagatggttatcacattgctactgtttcacatgtcccaaccattaaactgtcccgcagaaccagtaaggaccaggatgtaggacaggctgaatttgcagaagaccaagcttcgacttaa

Protein Analysis

112

Amino Acids

12.37

Weight (kDa)

8.1

Isoelectric Point (pI)

26.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020449)

Species Orthologous Gene IDs
pyrus_communis pycom14g06980
rosa_laevigata RLG00000024680
rosa_multiflora Rmu_sc0002031.1_g000008 Rmu_sc0014550.1_g000012
rosa_samantha Rh3BG135500 Rh3DG137100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 274
AcsI RAATTY 3 cut(s) 28, 149, 311
AflIII ACRYGT 1 cut(s) 250
AjnI CCWGG 1 cut(s) 291
AluBI AGCT 1 cut(s) 329
AluI AGCT 1 cut(s) 329
Alw26I GTCTC 2 cut(s) 74, 184
Ama87I CYCGRG 1 cut(s) 144
ApoI RAATTY 3 cut(s) 28, 149, 311
ArsI GACNNNNNNTTYG 2 cut(s) 122, 154
AspS9I GGNCC 1 cut(s) 289
AvaI CYCGRG 1 cut(s) 144
AvaII GGWCC 1 cut(s) 289
BbsI GAAGAC 1 cut(s) 327
BccI CCATC 2 cut(s) 83, 218
BciT130I CCWGG 1 cut(s) 293
BcoDI GTCTC 2 cut(s) 74, 184
BfmI CTRYAG 1 cut(s) 123
Bme1390I CCNGG 1 cut(s) 293
Bme18I GGWCC 1 cut(s) 289
BmeT110I CYCGRG 1 cut(s) 144
BmgT120I GGNCC 1 cut(s) 289
BmrFI CCNGG 1 cut(s) 293
BoxI GACNNNNGTC 1 cut(s) 170
BpiI GAAGAC 1 cut(s) 327
BpmI CTGGAG 1 cut(s) 166
BpuEI CTTGAG 1 cut(s) 69
BsaBI GATNNNNATC 1 cut(s) 228
Bse1I ACTGG 1 cut(s) 282
Bse3DI GCAATG 1 cut(s) 234
Bse8I GATNNNNATC 1 cut(s) 228
BseBI CCWGG 1 cut(s) 293
BseGI GGATG 2 cut(s) 217, 301
BseJI GATNNNNATC 1 cut(s) 228
BseMI GCAATG 1 cut(s) 234
BseNI ACTGG 1 cut(s) 282
BsiHKCI CYCGRG 1 cut(s) 144
BslFI GGGAC 2 cut(s) 239, 256
BsmAI GTCTC 2 cut(s) 74, 184
BsmFI GGGAC 2 cut(s) 239, 256
BsoBI CYCGRG 1 cut(s) 144
BspACI CCGC 1 cut(s) 274
BsrDI GCAATG 1 cut(s) 234
BsrI ACTGG 1 cut(s) 282
Bst2UI CCWGG 1 cut(s) 293
Bst4CI ACNGT 2 cut(s) 244, 270
BstF5I GGATG 2 cut(s) 217, 301
BstMAI GTCTC 2 cut(s) 74, 184
BstMWI GCNNNNNNNGC 2 cut(s) 200, 314
BstNI CCWGG 1 cut(s) 293
BstNSI RCATGY 1 cut(s) 254
BstPAI GACNNNNGTC 1 cut(s) 170
BstSCI CCNGG 1 cut(s) 291
BstSFI CTRYAG 1 cut(s) 123
BstV2I GAAGAC 1 cut(s) 327
BtsCI GGATG 2 cut(s) 217, 301
Cfr13I GGNCC 1 cut(s) 289
CviAII CATG 2 cut(s) 188, 251
CviJI RGCY 3 cut(s) 143, 308, 329
CviKI_1 RGCY 3 cut(s) 143, 308, 329
Eco47I GGWCC 1 cut(s) 289
Eco88I CYCGRG 1 cut(s) 144
EcoRI GAATTC 1 cut(s) 28
EcoRII CCWGG 1 cut(s) 291
FaeI CATG 2 cut(s) 191, 254
FaiI YATR 7 cut(s) 23, 35, 37, 62, 117, 189, 252
FaqI GGGAC 2 cut(s) 239, 256
FatI CATG 2 cut(s) 187, 250
FauI CCCGC 1 cut(s) 281
FokI GGATG 2 cut(s) 224, 308
GsuI CTGGAG 1 cut(s) 166
Hin1II CATG 2 cut(s) 191, 254
HindIII AAGCTT 1 cut(s) 327
HinfI GANTC 2 cut(s) 82, 177
Hpy188I TCNGA 1 cut(s) 176
Hpy188III TCNNGA 3 cut(s) 86, 183, 219
HpyCH4III ACNGT 2 cut(s) 244, 270
HpyCH4V TGCA 1 cut(s) 317
HpyF10VI GCNNNNNNNGC 2 cut(s) 200, 314
Hsp92II CATG 2 cut(s) 191, 254
LpnPI CCDG 7 cut(s) 53, 196, 204, 278, 290, 295, 305
MaeIII GTNAC 2 cut(s) 103, 118
MboII GAAGA 1 cut(s) 332
MluCI AATT 3 cut(s) 28, 149, 311
MlyI GAGTC 2 cut(s) 76, 186
MmeI TCCRAC 1 cut(s) 25
MnlI CCTC 1 cut(s) 156
MseI TTAA 4 cut(s) 17, 153, 264, 337
MspR9I CCNGG 1 cut(s) 293
MvaI CCWGG 1 cut(s) 293
MwoI GCNNNNNNNGC 2 cut(s) 200, 314
NlaIII CATG 2 cut(s) 191, 254
NspI RCATGY 1 cut(s) 254
PciI ACATGT 1 cut(s) 250
PleI GAGTC 2 cut(s) 76, 185
PpsI GAGTC 2 cut(s) 76, 185
PscI ACATGT 1 cut(s) 250
PshAI GACNNNNGTC 1 cut(s) 170
Psp6I CCWGG 1 cut(s) 291
PspGI CCWGG 1 cut(s) 291
PspPI GGNCC 1 cut(s) 289
SaqAI TTAA 4 cut(s) 17, 153, 264, 337
Sau96I GGNCC 1 cut(s) 289
SchI GAGTC 2 cut(s) 76, 186
ScrFI CCNGG 1 cut(s) 293
SetI ASST 4 cut(s) 72, 140, 159, 331
SfcI CTRYAG 1 cut(s) 123
SinI GGWCC 1 cut(s) 289
SmlI CTYRAG 1 cut(s) 84
SmoI CTYRAG 1 cut(s) 84
Sse9I AATT 3 cut(s) 28, 149, 311
SsiI CCGC 1 cut(s) 274
StyD4I CCNGG 1 cut(s) 291
TaaI ACNGT 2 cut(s) 244, 270
TaqI TCGA 2 cut(s) 72, 332
TasI AATT 3 cut(s) 28, 149, 311
Tru1I TTAA 4 cut(s) 17, 153, 264, 337
Tru9I TTAA 4 cut(s) 17, 153, 264, 337
TspDTI ATGAA 1 cut(s) 204
VpaK11BI GGWCC 1 cut(s) 289
XapI RAATTY 3 cut(s) 28, 149, 311
XceI RCATGY 1 cut(s) 254
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.