Rmu_sc0002091.1_g000003

Protein FAR1-RELATED SEQUENCE

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002091.1
OG0020671
Physical Location & Seq
Reverse (-)
8203 .. 9292
1090 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 864 bp
atggagacctacacatgggtcttggaaacgttcttggaagcaatgaagggcaagaagcctacggctgttttgacagatggagacaaggcaatgcgcaaagcaattgtagaagttttcccccaagcaaagcaccgcatatgttcctggcatgttggtaaaaacatggctgaaaaaattaaagacgaggaccgcagaaaagagttcagagagtgtatgtataactcatggtcaacagtcgagtgggaagaagcttggcggaacatggtacaaaaaattgaggaggcagaagcatctgaaggagttgaaaatttgctgcagatgatgtatcaagaaagggaatgttgggcagaagcttttttcactggacatttctttggtggtatgacaagtacccaaagatgtgaaggaatgaataaaaagtttggaatagggaggaactcgaagccagtcctcaccactcacatgcaagcattggaggataagcttgctaagaagctgacccatgacatgtatttggtggctagacttcagattaagcgtgagaaaagttattttgtgacaaatatgatctcattttctggttcaactgtgttctatgtgatgaagtataaacaaccgcaattggtatggaatgtggaagtcgggatggggcaaggagatcctcactatatctgctcctgcaagttatttgagtctgatgggattccttgctctcatattttttgtgtgatgaaatacaagcagattgaggtcttaccagactcgttaatccatgagcgatggaccaagagtgctagagataaacataaggatgtggcactgctgaaccaaggttcagataaaactatgcagattggttcataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAR1 MULE SWIM

Protein Analysis

287

Amino Acids

33.39

Weight (kDa)

8.31

Isoelectric Point (pI)

37.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MULE PF10551 2 - 54 4.6e-14 MULE transposase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020671)

Species Orthologous Gene IDs
rosa_laevigata RLG00000018818
rosa_multiflora Rmu_sc0002091.1_g000003
rosa_roxburghii Rroxscaffold_2G00123750
rosa_rugosa Rorug05G0555000
rosa_samantha Rh2AG039300 Rh2CG318600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 95
AciI CCGC 4 cut(s) 133, 190, 256, 617
AclI AACGTT 1 cut(s) 29
AclWI GGATC 1 cut(s) 653
AcsI RAATTY 1 cut(s) 307
AcuI CTGAAG 2 cut(s) 315, 512
AfaI GTAC 2 cut(s) 267, 391
AfiI CCNNNNNNNGG 1 cut(s) 15
AflIII ACRYGT 1 cut(s) 507
AgsI TTSAA 2 cut(s) 305, 585
AjnI CCWGG 1 cut(s) 143
AluBI AGCT 4 cut(s) 251, 353, 484, 496
AluI AGCT 4 cut(s) 251, 353, 484, 496
Alw26I GTCTC 1 cut(s) 75
AlwI GGATC 1 cut(s) 653
ApeKI GCWGC 1 cut(s) 313
ApoI RAATTY 1 cut(s) 307
AspLEI GCGC 1 cut(s) 96
AspS9I GGNCC 2 cut(s) 187, 783
AsuHPI GGTGA 1 cut(s) 445
AvaII GGWCC 2 cut(s) 187, 783
BbvI GCAGC 1 cut(s) 300
BccI CCATC 4 cut(s) 71, 640, 692, 774
BceAI ACGGC 1 cut(s) 78
BciT130I CCWGG 1 cut(s) 145
BcoDI GTCTC 1 cut(s) 75
BfaI CTAG 2 cut(s) 522, 795
BfmI CTRYAG 1 cut(s) 314
BisI GCNGC 1 cut(s) 314
BlsI GCNGC 1 cut(s) 315
Bme1390I CCNGG 1 cut(s) 145
Bme18I GGWCC 2 cut(s) 187, 783
BmgT120I GGNCC 2 cut(s) 187, 783
BmrFI CCNGG 1 cut(s) 145
BmsI GCATC 1 cut(s) 299
BsaJI CCNNGG 1 cut(s) 829
Bsc4I CCNNNNNNNGG 1 cut(s) 15
Bse1I ACTGG 2 cut(s) 367, 446
Bse3DI GCAATG 2 cut(s) 48, 96
BseBI CCWGG 1 cut(s) 145
BseDI CCNNGG 1 cut(s) 829
BseGI GGATG 2 cut(s) 651, 817
BseLI CCNNNNNNNGG 1 cut(s) 15
BseMI GCAATG 2 cut(s) 48, 96
BseNI ACTGG 2 cut(s) 367, 446
BseRI GAGGAG 1 cut(s) 293
BseXI GCAGC 1 cut(s) 300
BslI CCNNNNNNNGG 1 cut(s) 15
BsmAI GTCTC 1 cut(s) 75
Bsp143I GATC 2 cut(s) 567, 658
BspACI CCGC 4 cut(s) 133, 190, 256, 617
BspMAI CTGCAG 1 cut(s) 318
BspPI GGATC 1 cut(s) 653
BsrDI GCAATG 2 cut(s) 48, 96
BsrI ACTGG 2 cut(s) 367, 446
BssECI CCNNGG 1 cut(s) 829
BssMI GATC 2 cut(s) 567, 658
BssT1I CCWWGG 1 cut(s) 829
Bst2UI CCWGG 1 cut(s) 145
Bst4CI ACNGT 2 cut(s) 235, 589
BstC8I GCNNGC 2 cut(s) 468, 486
BstDEI CTNAG 1 cut(s) 489
BstF5I GGATG 2 cut(s) 651, 817
BstHHI GCGC 1 cut(s) 96
BstKTI GATC 2 cut(s) 570, 661
BstMAI GTCTC 1 cut(s) 75
BstMBI GATC 2 cut(s) 567, 658
BstNI CCWGG 1 cut(s) 145
BstNSI RCATGY 3 cut(s) 152, 466, 511
BstSCI CCNGG 1 cut(s) 143
BstSFI CTRYAG 1 cut(s) 314
BstV1I GCAGC 1 cut(s) 300
BstX2I RGATCY 1 cut(s) 658
BstYI RGATCY 1 cut(s) 658
BtgZI GCGATG 1 cut(s) 793
BtsCI GGATG 2 cut(s) 651, 817
BtsI GCAGTG 1 cut(s) 818
BtsIMutI CAGTG 2 cut(s) 360, 818
Cac8I GCNNGC 2 cut(s) 468, 486
CfoI GCGC 1 cut(s) 96
Cfr13I GGNCC 2 cut(s) 187, 783
Csp6I GTAC 2 cut(s) 266, 390
CviAII CATG 9 cut(s) 15, 149, 163, 225, 262, 463, 503, 508, 773
CviJI RGCY 9 cut(s) 58, 65, 167, 251, 353, 445, 484, 496, 521
CviKI_1 RGCY 9 cut(s) 58, 65, 167, 251, 353, 445, 484, 496, 521
CviQI GTAC 2 cut(s) 266, 390
DdeI CTNAG 1 cut(s) 489
DpnI GATC 2 cut(s) 569, 660
DpnII GATC 2 cut(s) 567, 658
EciI GGCGGA 1 cut(s) 271
Eco130I CCWWGG 1 cut(s) 829
Eco47I GGWCC 2 cut(s) 187, 783
Eco57I CTGAAG 2 cut(s) 315, 512
EcoRII CCWGG 1 cut(s) 143
EcoT14I CCWWGG 1 cut(s) 829
ErhI CCWWGG 1 cut(s) 829
FaeI CATG 9 cut(s) 18, 152, 166, 228, 265, 466, 506, 511, 776
FatI CATG 9 cut(s) 14, 148, 162, 224, 261, 462, 502, 507, 772
FauNDI CATATG 1 cut(s) 137
Fnu4HI GCNGC 1 cut(s) 314
FokI GGATG 2 cut(s) 658, 824
Fsp4HI GCNGC 1 cut(s) 314
FspBI CTAG 2 cut(s) 522, 795
FspI TGCGCA 1 cut(s) 95
GlaI GCGC 1 cut(s) 95
GluI GCNGC 1 cut(s) 314
HhaI GCGC 1 cut(s) 96
Hin1II CATG 9 cut(s) 18, 152, 166, 228, 265, 466, 506, 511, 776
Hin6I GCGC 1 cut(s) 94
HinP1I GCGC 1 cut(s) 94
HincII GTYRAC 1 cut(s) 231
HindII GTYRAC 1 cut(s) 231
HindIII AAGCTT 3 cut(s) 249, 351, 482
HinfI GANTC 3 cut(s) 692, 703, 761
HphI GGTGA 1 cut(s) 445
Hpy166II GTNNAC 1 cut(s) 231
Hpy188I TCNGA 5 cut(s) 206, 295, 531, 697, 838
Hpy188III TCNNGA 2 cut(s) 329, 643
Hpy8I GTNNAC 1 cut(s) 231
HpyAV CCTTC 3 cut(s) 40, 290, 398
HpyCH4III ACNGT 2 cut(s) 235, 589
HpyCH4IV ACGT 1 cut(s) 29
HpyCH4V TGCA 4 cut(s) 316, 466, 681, 850
HpyF3I CTNAG 1 cut(s) 489
HpySE526I ACGT 1 cut(s) 29
Hsp92II CATG 9 cut(s) 18, 152, 166, 228, 265, 466, 506, 511, 776
HspAI GCGC 1 cut(s) 94
Kzo9I GATC 2 cut(s) 567, 658
LmnI GCTCC 1 cut(s) 680
LpnPI CCDG 7 cut(s) 130, 157, 348, 459, 564, 691, 771
Lsp1109I GCAGC 1 cut(s) 300
LweI GCATC 1 cut(s) 299
MaeI CTAG 2 cut(s) 522, 795
MaeII ACGT 1 cut(s) 29
MaeIII GTNAC 1 cut(s) 556
MalI GATC 2 cut(s) 569, 660
MboI GATC 2 cut(s) 567, 658
MboII GAAGA 1 cut(s) 257
MfeI CAATTG 2 cut(s) 102, 620
MflI RGATCY 1 cut(s) 658
MluCI AATT 5 cut(s) 102, 174, 273, 307, 620
MlyI GAGTC 2 cut(s) 701, 755
MnlI CCTC 8 cut(s) 178, 271, 274, 426, 461, 469, 672, 742
MseI TTAA 3 cut(s) 177, 534, 767
MslI CAYNNNNRTG 2 cut(s) 461, 810
MspR9I CCNGG 1 cut(s) 145
MunI CAATTG 2 cut(s) 102, 620
MvaI CCWGG 1 cut(s) 145
NdeI CATATG 1 cut(s) 137
NdeII GATC 2 cut(s) 567, 658
NlaIII CATG 9 cut(s) 18, 152, 166, 228, 265, 466, 506, 511, 776
NmuCI GTSAC 1 cut(s) 556
NsbI TGCGCA 1 cut(s) 95
NspI RCATGY 3 cut(s) 152, 466, 511
PciI ACATGT 1 cut(s) 507
PfeI GAWTC 1 cut(s) 703
PkrI GCNGC 1 cut(s) 315
PleI GAGTC 2 cut(s) 700, 755
PpsI GAGTC 2 cut(s) 700, 755
PscI ACATGT 1 cut(s) 507
Psp1406I AACGTT 1 cut(s) 29
Psp6I CCWGG 1 cut(s) 143
PspGI CCWGG 1 cut(s) 143
PspPI GGNCC 2 cut(s) 187, 783
PstI CTGCAG 1 cut(s) 318
PsuI RGATCY 1 cut(s) 658
RsaI GTAC 2 cut(s) 267, 391
RsaNI GTAC 2 cut(s) 266, 390
RseI CAYNNNNRTG 2 cut(s) 461, 810
SaqAI TTAA 3 cut(s) 177, 534, 767
SatI GCNGC 1 cut(s) 314
Sau3AI GATC 2 cut(s) 567, 658
Sau96I GGNCC 2 cut(s) 187, 783
SchI GAGTC 2 cut(s) 701, 755
ScrFI CCNGG 1 cut(s) 145
SetI ASST 8 cut(s) 11, 32, 253, 355, 486, 498, 753, 835
SfaNI GCATC 1 cut(s) 299
SfcI CTRYAG 1 cut(s) 314
SinI GGWCC 2 cut(s) 187, 783
SmiMI CAYNNNNRTG 2 cut(s) 461, 810
Sse9I AATT 5 cut(s) 102, 174, 273, 307, 620
SsiI CCGC 4 cut(s) 133, 190, 256, 617
SspMI CTAG 2 cut(s) 522, 795
StyD4I CCNGG 1 cut(s) 143
StyI CCWWGG 1 cut(s) 829
TaaI ACNGT 2 cut(s) 235, 589
TaiI ACGT 1 cut(s) 32
TaqI TCGA 2 cut(s) 237, 440
TasI AATT 5 cut(s) 102, 174, 273, 307, 620
TfiI GAWTC 1 cut(s) 703
Tru1I TTAA 3 cut(s) 177, 534, 767
Tru9I TTAA 3 cut(s) 177, 534, 767
TscAI CASTG 2 cut(s) 367, 825
TseFI GTSAC 1 cut(s) 556
TseI GCWGC 1 cut(s) 313
Tsp45I GTSAC 1 cut(s) 556
TspDTI ATGAA 5 cut(s) 59, 425, 617, 746, 849
TspRI CASTG 2 cut(s) 367, 825
VpaK11BI GGWCC 2 cut(s) 187, 783
XapI RAATTY 1 cut(s) 307
XceI RCATGY 3 cut(s) 152, 466, 511
XspI CTAG 2 cut(s) 522, 795
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.