Rmu_sc0002106.1_g000011

Histone H2A

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002106.1
Physical Location & Seq
Reverse (-)
66104 .. 66743
640 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002106.1_g000011.1.cds

Sequence Viewer

Length: 375 bp
atgggtgttccagagggagctgaagtgcaagccagaggaaggaagggcgatagccccaagaagaaggcggtgattcgttccgtcaaagccggtctacaatttccggtctgtaggattggccgctacttaaagaagggaaggtatgctcagcgtgtcagctccggtgctccggtgctggagttgtctggaaatgcagctcggggcaacaagaagaacatgattatcccaaggcatctgttattggctgtgaggaatgacgaagggcttggcttcttgctggggttactattggtcatggagttgcgcttcaatcaggttgaaatcaagcagtctgagatgatcagtcacttctttgttgcgtctggcgtatcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

13.56

Weight (kDa)

10.6

Isoelectric Point (pI)

36.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019877)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 94
AciI CCGC 2 cut(s) 68, 121
AcoI YGGCCR 1 cut(s) 118
AcuI CTGAAG 1 cut(s) 42
AfiI CCNNNNNNNGG 1 cut(s) 39
AgsI TTSAA 2 cut(s) 310, 320
AluBI AGCT 3 cut(s) 20, 159, 197
AluI AGCT 3 cut(s) 20, 159, 197
Alw21I GWGCWC 1 cut(s) 169
Ama87I CYCGRG 1 cut(s) 198
AoxI GGCC 1 cut(s) 118
ApeKI GCWGC 1 cut(s) 194
AspLEI GCGC 1 cut(s) 306
AsuHPI GGTGA 1 cut(s) 82
AvaI CYCGRG 1 cut(s) 198
Bbv12I GWGCWC 1 cut(s) 169
BbvI GCAGC 1 cut(s) 206
BclI TGATCA 1 cut(s) 339
BfmI CTRYAG 1 cut(s) 109
BisI GCNGC 2 cut(s) 121, 195
BlpI GCTNAGC 1 cut(s) 147
BlsI GCNGC 2 cut(s) 122, 196
BmeT110I CYCGRG 1 cut(s) 198
BmsI GCATC 1 cut(s) 241
BpmI CTGGAG 1 cut(s) 197
Bpu1102I GCTNAGC 1 cut(s) 147
BsaJI CCNNGG 1 cut(s) 227
BsaWI WCCGGW 3 cut(s) 103, 161, 169
BsaXI ACNNNNNCTCC 2 cut(s) 9, 39
Bsc4I CCNNNNNNNGG 1 cut(s) 39
Bse118I RCCGGY 1 cut(s) 89
BseDI CCNNGG 1 cut(s) 227
BseLI CCNNNNNNNGG 1 cut(s) 39
BseMII CTCAG 2 cut(s) 161, 324
BseXI GCAGC 1 cut(s) 206
BseYI CCCAGC 1 cut(s) 277
BshFI GGCC 1 cut(s) 120
BsiHKAI GWGCWC 1 cut(s) 169
BsiHKCI CYCGRG 1 cut(s) 198
BsiSI CCGG 4 cut(s) 90, 104, 162, 170
BslI CCNNNNNNNGG 1 cut(s) 39
BsnI GGCC 1 cut(s) 120
BsoBI CYCGRG 1 cut(s) 198
Bsp1286I GDGCHC 1 cut(s) 169
Bsp143I GATC 1 cut(s) 339
Bsp1720I GCTNAGC 1 cut(s) 147
BspACI CCGC 2 cut(s) 68, 121
BspANI GGCC 1 cut(s) 120
BspCNI CTCAG 2 cut(s) 160, 325
BsrFI RCCGGY 1 cut(s) 89
BssAI RCCGGY 1 cut(s) 89
BssECI CCNNGG 1 cut(s) 227
BssMI GATC 1 cut(s) 339
BssT1I CCWWGG 1 cut(s) 227
BstC8I GCNNGC 1 cut(s) 30
BstDEI CTNAG 2 cut(s) 147, 333
BstHHI GCGC 1 cut(s) 306
BstKTI GATC 1 cut(s) 342
BstMBI GATC 1 cut(s) 339
BstSFI CTRYAG 1 cut(s) 109
BstV1I GCAGC 1 cut(s) 206
BsuRI GGCC 1 cut(s) 120
Cac8I GCNNGC 1 cut(s) 30
CfoI GCGC 1 cut(s) 306
Cfr10I RCCGGY 1 cut(s) 89
CseI GACGC 1 cut(s) 348
CviAII CATG 2 cut(s) 217, 295
DdeI CTNAG 2 cut(s) 147, 333
DpnI GATC 1 cut(s) 341
DpnII GATC 1 cut(s) 339
EaeI YGGCCR 1 cut(s) 118
Eco130I CCWWGG 1 cut(s) 227
Eco57I CTGAAG 1 cut(s) 42
Eco88I CYCGRG 1 cut(s) 198
EcoT14I CCWWGG 1 cut(s) 227
ErhI CCWWGG 1 cut(s) 227
FaeI CATG 2 cut(s) 220, 298
FaiI YATR 4 cut(s) 144, 218, 296, 373
FatI CATG 2 cut(s) 216, 294
FbaI TGATCA 1 cut(s) 339
FblI GTMKAC 1 cut(s) 94
Fnu4HI GCNGC 2 cut(s) 121, 195
Fsp4HI GCNGC 2 cut(s) 121, 195
GlaI GCGC 1 cut(s) 305
GluI GCNGC 2 cut(s) 121, 195
GsaI CCCAGC 1 cut(s) 281
GsuI CTGGAG 1 cut(s) 197
HaeIII GGCC 1 cut(s) 120
HapII CCGG 4 cut(s) 90, 104, 162, 170
HgaI GACGC 1 cut(s) 348
HhaI GCGC 1 cut(s) 306
Hin1II CATG 2 cut(s) 220, 298
Hin6I GCGC 1 cut(s) 304
HinP1I GCGC 1 cut(s) 304
HinfI GANTC 1 cut(s) 73
HpaII CCGG 4 cut(s) 90, 104, 162, 170
HphI GGTGA 1 cut(s) 82
Hpy166II GTNNAC 1 cut(s) 95
Hpy188I TCNGA 1 cut(s) 334
Hpy188III TCNNGA 2 cut(s) 11, 186
Hpy8I GTNNAC 1 cut(s) 95
HpyAV CCTTC 6 cut(s) 33, 37, 58, 127, 132, 254
HpyCH4V TGCA 2 cut(s) 28, 194
HpyF3I CTNAG 2 cut(s) 147, 333
Hsp92II CATG 2 cut(s) 220, 298
HspAI GCGC 1 cut(s) 304
Ksp22I TGATCA 1 cut(s) 339
Kzo9I GATC 1 cut(s) 339
LmnI GCTCC 3 cut(s) 17, 164, 172
Lsp1109I GCAGC 1 cut(s) 206
LweI GCATC 1 cut(s) 241
MaeIII GTNAC 2 cut(s) 282, 344
MalI GATC 1 cut(s) 341
MboI GATC 1 cut(s) 339
MboII GAAGA 2 cut(s) 73, 223
MhlI GDGCHC 1 cut(s) 169
MluCI AATT 1 cut(s) 98
MnlI CCTC 3 cut(s) 7, 29, 243
MseI TTAA 1 cut(s) 128
MspI CCGG 4 cut(s) 90, 104, 162, 170
NdeII GATC 1 cut(s) 339
NlaIII CATG 2 cut(s) 220, 298
NmuCI GTSAC 1 cut(s) 344
PfeI GAWTC 1 cut(s) 73
PkrI GCNGC 2 cut(s) 122, 196
PspFI CCCAGC 1 cut(s) 277
SaqAI TTAA 1 cut(s) 128
SatI GCNGC 2 cut(s) 121, 195
Sau3AI GATC 1 cut(s) 339
SduI GDGCHC 1 cut(s) 169
SetI ASST 5 cut(s) 22, 143, 161, 199, 318
SfaNI GCATC 1 cut(s) 241
SfcI CTRYAG 1 cut(s) 109
Sse9I AATT 1 cut(s) 98
SsiI CCGC 2 cut(s) 68, 121
StyI CCWWGG 1 cut(s) 227
TasI AATT 1 cut(s) 98
TauI GCSGC 1 cut(s) 123
TfiI GAWTC 1 cut(s) 73
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
TseFI GTSAC 1 cut(s) 344
TseI GCWGC 1 cut(s) 194
Tsp45I GTSAC 1 cut(s) 344
TspGWI ACGGA 1 cut(s) 70
XmiI GTMKAC 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.