Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002126.1

Orthogroup ID

OG0019316

Physical Location & Seq

Genomic Coordinates Forward (+)

109195 .. 109564

Gene Structure 370 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002126.1_g000021.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 279 bp

atgattgctactttgcttatgaaagttgcaggagctgatcaagaacatcgacctagcggtctgaaattcaatacagcattcaaagatgtcaagggtgttgatgaggctaaagctgagctcgaggaaattgttcactatcttcgaaatcccgagcaattcacccgcttcggaggtagacttccgaaaggtgttttactgatcggtccacccggcacaggtaagaccatgttagtcagagctgttgcaacagaagccgacgttacctttcttcgcatgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004176 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008237 GO:0009507 GO:0009526 GO:0009536 GO:0009941 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0019538 GO:0031967 GO:0031975 GO:0042623 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko04139 map04139

Pfam Domains

Protein Families

AAA Peptidase_M41

Protein Analysis

92

Amino Acids

10.1

Weight (kDa)

9.15

Isoelectric Point (pI)

27.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019316)

Species	Orthologous Gene IDs
pyrus_communis	pycom03g06990
rosa_chinensis	RchiOBHm_Chr2g0093611
rosa_multiflora	Rmu_sc0002126.1_g000021 Rmu_sc0021295.1_g000003
rosa_samantha	Rh2AG084400 Rh2BG085000 Rh2CG087300 Rh2DG083000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	57
AccI	GTMKAC	1 cut(s)	175
AciI	CCGC	2 cut(s)	57, 163
AcsI	RAATTY	1 cut(s)	65
AfiI	CCNNNNNNNGG	1 cut(s)	215
AgsI	TTSAA	2 cut(s)	70, 82
AluBI	AGCT	4 cut(s)	35, 113, 118, 239
AluI	AGCT	4 cut(s)	35, 113, 118, 239
Alw21I	GWGCWC	1 cut(s)	120
AlwNI	CAGNNNCTG	1 cut(s)	35
Ama87I	CYCGRG	2 cut(s)	119, 149
ApoI	RAATTY	1 cut(s)	65
Asp700I	GAANNNNTTC	1 cut(s)	129
AspS9I	GGNCC	1 cut(s)	203
AsuC2I	CCSGG	1 cut(s)	210
AsuHPI	GGTGA	1 cut(s)	151
AsuII	TTCGAA	1 cut(s)	142
AvaI	CYCGRG	2 cut(s)	119, 149
AvaII	GGWCC	1 cut(s)	203
BanII	GRGCYC	1 cut(s)	120
Bbv12I	GWGCWC	1 cut(s)	120
BclI	TGATCA	1 cut(s)	37
BcnI	CCSGG	1 cut(s)	210
BfaI	CTAG	1 cut(s)	54
BlpI	GCTNAGC	1 cut(s)	114
Bme1390I	CCNGG	1 cut(s)	210
Bme18I	GGWCC	1 cut(s)	203
BmeT110I	CYCGRG	2 cut(s)	119, 149
BmgT120I	GGNCC	1 cut(s)	203
BmrFI	CCNGG	1 cut(s)	210
Bpu1102I	GCTNAGC	1 cut(s)	114
Bpu14I	TTCGAA	1 cut(s)	142
BpuMI	CCSGG	1 cut(s)	210
Bsc4I	CCNNNNNNNGG	1 cut(s)	215
BseLI	CCNNNNNNNGG	1 cut(s)	215
BseMII	CTCAG	1 cut(s)	105
BsiHKAI	GWGCWC	1 cut(s)	120
BsiHKCI	CYCGRG	2 cut(s)	119, 149
BsiSI	CCGG	1 cut(s)	210
BslI	CCNNNNNNNGG	1 cut(s)	215
BsmI	GAATGC	1 cut(s)	77
BsoBI	CYCGRG	2 cut(s)	119, 149
Bsp119I	TTCGAA	1 cut(s)	142
Bsp1286I	GDGCHC	1 cut(s)	120
Bsp143I	GATC	2 cut(s)	37, 198
Bsp1720I	GCTNAGC	1 cut(s)	114
BspACI	CCGC	2 cut(s)	57, 163
BspCNI	CTCAG	1 cut(s)	106
BspT104I	TTCGAA	1 cut(s)	142
BssMI	GATC	2 cut(s)	37, 198
BstBI	TTCGAA	1 cut(s)	142
BstDEI	CTNAG	1 cut(s)	114
BstKTI	GATC	2 cut(s)	40, 201
BstMBI	GATC	2 cut(s)	37, 198
BstMWI	GCNNNNNNNGC	1 cut(s)	251
BstNSI	RCATGY	1 cut(s)	277
BstSCI	CCNGG	1 cut(s)	208
CaiI	CAGNNNCTG	1 cut(s)	35
Cfr13I	GGNCC	1 cut(s)	203
CviAII	CATG	2 cut(s)	226, 274
CviJI	RGCY	6 cut(s)	35, 107, 113, 118, 239, 254
CviKI_1	RGCY	6 cut(s)	35, 107, 113, 118, 239, 254
DdeI	CTNAG	1 cut(s)	114
DpnI	GATC	2 cut(s)	39, 200
DpnII	GATC	2 cut(s)	37, 198
DrdI	GACNNNNNNGTC	1 cut(s)	57
DseDI	GACNNNNNNGTC	1 cut(s)	57
Ecl136II	GAGCTC	1 cut(s)	118
Eco24I	GRGCYC	1 cut(s)	120
Eco47I	GGWCC	1 cut(s)	203
Eco53kI	GAGCTC	1 cut(s)	118
Eco88I	CYCGRG	2 cut(s)	119, 149
EcoICRI	GAGCTC	1 cut(s)	118
EcoT38I	GRGCYC	1 cut(s)	120
FaeI	CATG	2 cut(s)	229, 277
FaiI	YATR	3 cut(s)	20, 227, 275
FatI	CATG	2 cut(s)	225, 273
FauI	CCCGC	1 cut(s)	170
FbaI	TGATCA	1 cut(s)	37
FblI	GTMKAC	1 cut(s)	175
FriOI	GRGCYC	1 cut(s)	120
FspBI	CTAG	1 cut(s)	54
HapII	CCGG	1 cut(s)	210
Hin1II	CATG	2 cut(s)	229, 277
HpaII	CCGG	1 cut(s)	210
HphI	GGTGA	1 cut(s)	151
Hpy166II	GTNNAC	3 cut(s)	133, 176, 206
Hpy188I	TCNGA	4 cut(s)	63, 170, 183, 236
Hpy188III	TCNNGA	2 cut(s)	41, 149
Hpy8I	GTNNAC	3 cut(s)	133, 176, 206
Hpy99I	CGWCG	1 cut(s)	260
HpyCH4IV	ACGT	1 cut(s)	258
HpyCH4V	TGCA	2 cut(s)	29, 245
HpyF10VI	GCNNNNNNNGC	1 cut(s)	251
HpyF3I	CTNAG	1 cut(s)	114
HpySE526I	ACGT	1 cut(s)	258
Hsp92II	CATG	2 cut(s)	229, 277
Ksp22I	TGATCA	1 cut(s)	37
Kzo9I	GATC	2 cut(s)	37, 198
LmnI	GCTCC	1 cut(s)	32
LpnPI	CCDG	3 cut(s)	15, 201, 223
MaeI	CTAG	1 cut(s)	54
MaeII	ACGT	1 cut(s)	258
MaeIII	GTNAC	1 cut(s)	259
MalI	GATC	2 cut(s)	39, 200
MboI	GATC	2 cut(s)	37, 198
MboII	GAAGA	2 cut(s)	131, 260
MhlI	GDGCHC	1 cut(s)	120
MluCI	AATT	3 cut(s)	65, 126, 155
MnlI	CCTC	3 cut(s)	97, 115, 164
MroXI	GAANNNNTTC	1 cut(s)	129
MspI	CCGG	1 cut(s)	210
MspR9I	CCNGG	1 cut(s)	210
Mva1269I	GAATGC	1 cut(s)	77
MwoI	GCNNNNNNNGC	1 cut(s)	251
NciI	CCSGG	1 cut(s)	210
NdeII	GATC	2 cut(s)	37, 198
NlaIII	CATG	2 cut(s)	229, 277
NspI	RCATGY	1 cut(s)	277
NspV	TTCGAA	1 cut(s)	142
PaeR7I	CTCGAG	1 cut(s)	119
PctI	GAATGC	1 cut(s)	77
PdmI	GAANNNNTTC	1 cut(s)	129
Psp124BI	GAGCTC	1 cut(s)	120
PspPI	GGNCC	1 cut(s)	203
PspXI	VCTCGAGB	1 cut(s)	119
PstNI	CAGNNNCTG	1 cut(s)	35
SacI	GAGCTC	1 cut(s)	120
Sau3AI	GATC	2 cut(s)	37, 198
Sau96I	GGNCC	1 cut(s)	203
ScrFI	CCNGG	1 cut(s)	210
SduI	GDGCHC	1 cut(s)	120
Sfr274I	CTCGAG	1 cut(s)	119
SfuI	TTCGAA	1 cut(s)	142
SinI	GGWCC	1 cut(s)	203
SlaI	CTCGAG	1 cut(s)	119
SmlI	CTYRAG	1 cut(s)	119
SmoI	CTYRAG	1 cut(s)	119
Sse9I	AATT	3 cut(s)	65, 126, 155
SsiI	CCGC	2 cut(s)	57, 163
SspMI	CTAG	1 cut(s)	54
SstI	GAGCTC	1 cut(s)	120
StyD4I	CCNGG	1 cut(s)	208
TaiI	ACGT	1 cut(s)	261
TaqI	TCGA	3 cut(s)	49, 120, 142
TaqII	GACCGA	1 cut(s)	191
TasI	AATT	3 cut(s)	65, 126, 155
TspDTI	ATGAA	1 cut(s)	35
VpaK11BI	GGWCC	1 cut(s)	203
XapI	RAATTY	1 cut(s)	65
XceI	RCATGY	1 cut(s)	277
XhoI	CTCGAG	1 cut(s)	119
XmiI	GTMKAC	1 cut(s)	175
XmnI	GAANNNNTTC	1 cut(s)	129
XspI	CTAG	1 cut(s)	54

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.