Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0021295.1

Orthogroup ID

OG0019316

Physical Location & Seq

Genomic Coordinates Reverse (-)

2676 .. 3378

Gene Structure 703 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0021295.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 420 bp

atgggagaggagagactccaaggtgaaacaggaaatggattccgaggctcacttgaagatgaagtcgcttcagctttttctacgaatattggcactctgggaactgcttgcgctcctactcgaaccgagataactgtcagcctaaagcaatttatctgctacatatcggctggagctgatcaagaacatcgacctagcggtctgaaattcaatacagcattcaaagatgtcaagggtgttgatgaggctaaagctgagctcgaggaaattgttcactatcttcgaaatcccgagcaattcacccgcttcggaggtagacttccgaaaggtgttttacttgtcggtccacccggcacgggtaagaccatgttagccagagctgttgcaacagaagccgacgttacctttcttcgcatgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004176 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008237 GO:0009507 GO:0009526 GO:0009536 GO:0009941 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0019538 GO:0031967 GO:0031975 GO:0042623 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko04139 map04139

Pfam Domains

Protein Families

AAA Peptidase_M41

Protein Analysis

139

Amino Acids

14.99

Weight (kDa)

5.72

Isoelectric Point (pI)

32.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019316)

Species	Orthologous Gene IDs
pyrus_communis	pycom03g06990
rosa_chinensis	RchiOBHm_Chr2g0093611
rosa_multiflora	Rmu_sc0002126.1_g000021 Rmu_sc0021295.1_g000003
rosa_samantha	Rh2AG084400 Rh2BG085000 Rh2CG087300 Rh2DG083000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	198
AccI	GTMKAC	1 cut(s)	316
AciI	CCGC	2 cut(s)	198, 304
AcsI	RAATTY	1 cut(s)	206
AcuI	CTGAAG	1 cut(s)	54
AfiI	CCNNNNNNNGG	1 cut(s)	356
AgsI	TTSAA	3 cut(s)	56, 211, 223
AluBI	AGCT	5 cut(s)	74, 176, 254, 259, 380
AluI	AGCT	5 cut(s)	74, 176, 254, 259, 380
Alw21I	GWGCWC	1 cut(s)	261
Alw26I	GTCTC	1 cut(s)	7
Ama87I	CYCGRG	2 cut(s)	260, 290
ApoI	RAATTY	1 cut(s)	206
Asp700I	GAANNNNTTC	1 cut(s)	270
AspLEI	GCGC	1 cut(s)	113
AspS9I	GGNCC	1 cut(s)	344
AsuC2I	CCSGG	1 cut(s)	351
AsuHPI	GGTGA	2 cut(s)	35, 292
AsuII	TTCGAA	1 cut(s)	283
AvaI	CYCGRG	2 cut(s)	260, 290
AvaII	GGWCC	1 cut(s)	344
BanII	GRGCYC	1 cut(s)	261
Bbv12I	GWGCWC	1 cut(s)	261
BclI	TGATCA	1 cut(s)	178
BcnI	CCSGG	1 cut(s)	351
BcoDI	GTCTC	1 cut(s)	7
BfaI	CTAG	1 cut(s)	195
BlpI	GCTNAGC	1 cut(s)	255
Bme1390I	CCNGG	1 cut(s)	351
Bme18I	GGWCC	1 cut(s)	344
BmeT110I	CYCGRG	2 cut(s)	260, 290
BmgT120I	GGNCC	1 cut(s)	344
BmrFI	CCNGG	1 cut(s)	351
BpmI	CTGGAG	1 cut(s)	192
Bpu1102I	GCTNAGC	1 cut(s)	255
Bpu14I	TTCGAA	1 cut(s)	283
BpuMI	CCSGG	1 cut(s)	351
BsaJI	CCNNGG	2 cut(s)	19, 43
Bsc4I	CCNNNNNNNGG	1 cut(s)	356
BseDI	CCNNGG	2 cut(s)	19, 43
BseLI	CCNNNNNNNGG	1 cut(s)	356
BseMII	CTCAG	1 cut(s)	246
BseRI	GAGGAG	1 cut(s)	23
BsiHKAI	GWGCWC	1 cut(s)	261
BsiHKCI	CYCGRG	2 cut(s)	260, 290
BsiSI	CCGG	1 cut(s)	351
BslI	CCNNNNNNNGG	1 cut(s)	356
BsmAI	GTCTC	1 cut(s)	7
BsmI	GAATGC	1 cut(s)	218
BsoBI	CYCGRG	2 cut(s)	260, 290
Bsp119I	TTCGAA	1 cut(s)	283
Bsp1286I	GDGCHC	1 cut(s)	261
Bsp143I	GATC	1 cut(s)	178
Bsp1720I	GCTNAGC	1 cut(s)	255
BspACI	CCGC	2 cut(s)	198, 304
BspCNI	CTCAG	1 cut(s)	247
BspT104I	TTCGAA	1 cut(s)	283
BssECI	CCNNGG	2 cut(s)	19, 43
BssMI	GATC	1 cut(s)	178
BssT1I	CCWWGG	1 cut(s)	19
Bst4CI	ACNGT	1 cut(s)	136
BstBI	TTCGAA	1 cut(s)	283
BstC8I	GCNNGC	1 cut(s)	109
BstDEI	CTNAG	1 cut(s)	255
BstHHI	GCGC	1 cut(s)	113
BstKTI	GATC	1 cut(s)	181
BstMAI	GTCTC	1 cut(s)	7
BstMBI	GATC	1 cut(s)	178
BstMWI	GCNNNNNNNGC	1 cut(s)	392
BstNSI	RCATGY	1 cut(s)	418
BstSCI	CCNGG	1 cut(s)	349
Cac8I	GCNNGC	1 cut(s)	109
CfoI	GCGC	1 cut(s)	113
Cfr13I	GGNCC	1 cut(s)	344
CviAII	CATG	2 cut(s)	367, 415
DdeI	CTNAG	1 cut(s)	255
DpnI	GATC	1 cut(s)	180
DpnII	GATC	1 cut(s)	178
DrdI	GACNNNNNNGTC	1 cut(s)	198
DseDI	GACNNNNNNGTC	1 cut(s)	198
Ecl136II	GAGCTC	1 cut(s)	259
Eco130I	CCWWGG	1 cut(s)	19
Eco24I	GRGCYC	1 cut(s)	261
Eco47I	GGWCC	1 cut(s)	344
Eco53kI	GAGCTC	1 cut(s)	259
Eco57I	CTGAAG	1 cut(s)	54
Eco88I	CYCGRG	2 cut(s)	260, 290
EcoICRI	GAGCTC	1 cut(s)	259
EcoT14I	CCWWGG	1 cut(s)	19
EcoT38I	GRGCYC	1 cut(s)	261
ErhI	CCWWGG	1 cut(s)	19
FaeI	CATG	2 cut(s)	370, 418
FaiI	YATR	3 cut(s)	164, 368, 416
FatI	CATG	2 cut(s)	366, 414
FauI	CCCGC	1 cut(s)	311
FbaI	TGATCA	1 cut(s)	178
FblI	GTMKAC	1 cut(s)	316
FriOI	GRGCYC	1 cut(s)	261
FspBI	CTAG	1 cut(s)	195
GlaI	GCGC	1 cut(s)	112
GsuI	CTGGAG	1 cut(s)	192
HapII	CCGG	1 cut(s)	351
HhaI	GCGC	1 cut(s)	113
Hin1II	CATG	2 cut(s)	370, 418
Hin6I	GCGC	1 cut(s)	111
HinP1I	GCGC	1 cut(s)	111
HinfI	GANTC	2 cut(s)	15, 39
HpaII	CCGG	1 cut(s)	351
HphI	GGTGA	2 cut(s)	35, 292
Hpy166II	GTNNAC	3 cut(s)	274, 317, 347
Hpy188I	TCNGA	4 cut(s)	44, 204, 311, 324
Hpy188III	TCNNGA	2 cut(s)	182, 290
Hpy8I	GTNNAC	3 cut(s)	274, 317, 347
Hpy99I	CGWCG	1 cut(s)	401
HpyCH4III	ACNGT	1 cut(s)	136
HpyCH4IV	ACGT	1 cut(s)	399
HpyCH4V	TGCA	1 cut(s)	386
HpyF10VI	GCNNNNNNNGC	1 cut(s)	392
HpyF3I	CTNAG	1 cut(s)	255
HpySE526I	ACGT	1 cut(s)	399
Hsp92II	CATG	2 cut(s)	370, 418
HspAI	GCGC	1 cut(s)	111
Ksp22I	TGATCA	1 cut(s)	178
Kzo9I	GATC	1 cut(s)	178
LmnI	GCTCC	2 cut(s)	118, 173
LpnPI	CCDG	5 cut(s)	15, 83, 156, 364, 388
MaeI	CTAG	1 cut(s)	195
MaeII	ACGT	1 cut(s)	399
MaeIII	GTNAC	1 cut(s)	400
MalI	GATC	1 cut(s)	180
MboI	GATC	1 cut(s)	178
MboII	GAAGA	3 cut(s)	68, 272, 401
MhlI	GDGCHC	1 cut(s)	261
MluCI	AATT	4 cut(s)	149, 206, 267, 296
MlyI	GAGTC	1 cut(s)	9
MnlI	CCTC	4 cut(s)	38, 238, 256, 305
MroXI	GAANNNNTTC	1 cut(s)	270
MspI	CCGG	1 cut(s)	351
MspR9I	CCNGG	1 cut(s)	351
Mva1269I	GAATGC	1 cut(s)	218
MwoI	GCNNNNNNNGC	1 cut(s)	392
NciI	CCSGG	1 cut(s)	351
NdeII	GATC	1 cut(s)	178
NlaIII	CATG	2 cut(s)	370, 418
NspI	RCATGY	1 cut(s)	418
NspV	TTCGAA	1 cut(s)	283
PaeR7I	CTCGAG	1 cut(s)	260
PctI	GAATGC	1 cut(s)	218
PdmI	GAANNNNTTC	1 cut(s)	270
PfeI	GAWTC	1 cut(s)	39
PleI	GAGTC	1 cut(s)	9
PpsI	GAGTC	1 cut(s)	9
Psp124BI	GAGCTC	1 cut(s)	261
PspPI	GGNCC	1 cut(s)	344
PspXI	VCTCGAGB	1 cut(s)	260
SacI	GAGCTC	1 cut(s)	261
Sau3AI	GATC	1 cut(s)	178
Sau96I	GGNCC	1 cut(s)	344
SchI	GAGTC	1 cut(s)	9
ScrFI	CCNGG	1 cut(s)	351
SduI	GDGCHC	1 cut(s)	261
Sfr274I	CTCGAG	1 cut(s)	260
SfuI	TTCGAA	1 cut(s)	283
SinI	GGWCC	1 cut(s)	344
SlaI	CTCGAG	1 cut(s)	260
SmlI	CTYRAG	1 cut(s)	260
SmoI	CTYRAG	1 cut(s)	260
Sse9I	AATT	4 cut(s)	149, 206, 267, 296
SsiI	CCGC	2 cut(s)	198, 304
SspI	AATATT	1 cut(s)	88
SspMI	CTAG	1 cut(s)	195
SstI	GAGCTC	1 cut(s)	261
StyD4I	CCNGG	1 cut(s)	349
StyI	CCWWGG	1 cut(s)	19
TaaI	ACNGT	1 cut(s)	136
TaiI	ACGT	1 cut(s)	402
TaqI	TCGA	4 cut(s)	121, 190, 261, 283
TaqII	GACCGA	1 cut(s)	332
TasI	AATT	4 cut(s)	149, 206, 267, 296
TfiI	GAWTC	1 cut(s)	39
TspDTI	ATGAA	1 cut(s)	75
VpaK11BI	GGWCC	1 cut(s)	344
XapI	RAATTY	1 cut(s)	206
XceI	RCATGY	1 cut(s)	418
XhoI	CTCGAG	1 cut(s)	260
XmiI	GTMKAC	1 cut(s)	316
XmnI	GAANNNNTTC	1 cut(s)	270
XspI	CTAG	1 cut(s)	195

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.