Rmu_sc0002169.1_g000031

Cullin family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002169.1
Physical Location & Seq
Reverse (-)
168067 .. 170848
2782 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002169.1_g000031.1.cds

Sequence Viewer

Length: 933 bp
atgcagtttatacaacttgatgaaggattggtgattatagaagaggcgtttcagaaagcaaagaggattgtggaaggatatcctgacacaaagttcacctctgaagaatatatgaagttccatgcatgtgtttatactttgtgctataaacctggggatgacaacaaggtgttgctccacgaaaaatttaagaagagcttggaagagaccattaattccactgtactgccatctttagcagccaaagaaaatgaacttctgttgagggaacttgtgctgatgtggtcaaattacaagttaatggctaagtggttatgtagattctttgaatatcttgaccgctattatagcagtttttgttgtggtgtttcacttggtgagacctcgattgattgcttccgcagtatggtcttcaacgtgttgcatagtagaattcaggcagcagcaatgtctttgattaatgaagagcgtcatgggaagcagattgatccaaagctgctgcaagatgtcatgagtatctttatggaaattggcgaaaacagatcaacatcatattatgaaaactttgtacaggctatgcttgaagaaactgccgcattctactcccaatcatcttctcagtgggtggtttatgactcgttgaccgattatattcagaaggtgaactggtgcataatgcaggaaaaagaaagagctggccactatctacatcccacatcggtgaaaaaattaatacaggttttgcaatgccagttgctggatatgaacgcacttaaattggttgaaaagctacagtctcagaactccagtcaactggattatcaggagatattgtcaaaatgtgcctgcttaagtatcggagaggaaagctctacaccaacactcgcggaacatctttctgctttaatggcggaatccgctcatattcattga
Functional Annotation

Protein Analysis

310

Amino Acids

35.82

Weight (kDa)

5.36

Isoelectric Point (pI)

48.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017681)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g06190 FvH4_6g06190 FvH4_6g06190
rosa_chinensis RchiOBHm_Chr3g0455211
rosa_laevigata RLG00000025377
rosa_multiflora Rmu_sc0002169.1_g000031
rosa_roxburghii Rroxscaffold_6G00424470
rosa_rugosa Rorug03G0004900 Rorug03G0005000
rosa_samantha Rh3BG067400 Rh3CG065800
rosa_wichuraiana Rw3G005140

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 757
AccBSI CCGCTC 1 cut(s) 920
AccII CGCG 1 cut(s) 887
AciI CCGC 6 cut(s) 340, 400, 594, 887, 911, 918
AclWI GGATC 1 cut(s) 482
AcoI YGGCCR 1 cut(s) 697
AcsI RAATTY 2 cut(s) 185, 432
AcuI CTGAAG 1 cut(s) 123
AdeI CACNNNGTG 1 cut(s) 377
AfaI GTAC 2 cut(s) 225, 570
AfiI CCNNNNNNNGG 2 cut(s) 406, 757
AflII CTTAAG 1 cut(s) 850
AflIII ACRYGT 1 cut(s) 417
AgsI TTSAA 4 cut(s) 329, 415, 584, 785
AjnI CCWGG 1 cut(s) 151
AleI CACNNNNGTG 1 cut(s) 719
AluBI AGCT 5 cut(s) 198, 496, 695, 790, 870
AluI AGCT 5 cut(s) 198, 496, 695, 790, 870
Alw26I GTCTC 3 cut(s) 200, 374, 801
AlwI GGATC 1 cut(s) 482
AlwNI CAGNNNCTG 1 cut(s) 757
AoxI GGCC 1 cut(s) 697
ApeKI GCWGC 5 cut(s) 239, 440, 443, 496, 499
ApoI RAATTY 2 cut(s) 185, 432
AseI ATTAAT 3 cut(s) 213, 459, 731
AsuHPI GGTGA 5 cut(s) 43, 88, 389, 673, 733
BalI TGGCCA 1 cut(s) 699
BbsI GAAGAC 1 cut(s) 403
BbvI GCAGC 5 cut(s) 251, 452, 455, 483, 486
BccI CCATC 1 cut(s) 238
BciT130I CCWGG 1 cut(s) 153
BcoDI GTCTC 3 cut(s) 200, 374, 801
BfmI CTRYAG 1 cut(s) 791
BfrI CTTAAG 1 cut(s) 850
BisI GCNGC 6 cut(s) 240, 441, 444, 497, 500, 594
BlsI GCNGC 6 cut(s) 241, 442, 445, 498, 501, 595
Bme1390I CCNGG 1 cut(s) 153
BmrFI CCNGG 1 cut(s) 153
BpiI GAAGAC 1 cut(s) 403
BplI GAGNNNNNCTC 2 cut(s) 854, 886
BpmI CTGGAG 1 cut(s) 790
BsaBI GATNNNNATC 1 cut(s) 547
BsaI GGTCTC 2 cut(s) 200, 374
BsaJI CCNNGG 1 cut(s) 152
BsaXI ACNNNNNCTCC 2 cut(s) 818, 848
Bsc4I CCNNNNNNNGG 2 cut(s) 406, 757
Bse1I ACTGG 4 cut(s) 671, 751, 807, 819
Bse3DI GCAATG 2 cut(s) 453, 752
Bse8I GATNNNNATC 1 cut(s) 547
BseBI CCWGG 1 cut(s) 153
BseDI CCNNGG 1 cut(s) 152
BseGI GGATG 2 cut(s) 163, 709
BseJI GATNNNNATC 1 cut(s) 547
BseLI CCNNNNNNNGG 2 cut(s) 406, 757
BseMI GCAATG 2 cut(s) 453, 752
BseMII CTCAG 2 cut(s) 632, 812
BseNI ACTGG 4 cut(s) 671, 751, 807, 819
BseXI GCAGC 5 cut(s) 251, 452, 455, 483, 486
Bsh1236I CGCG 1 cut(s) 887
BshFI GGCC 1 cut(s) 699
BslI CCNNNNNNNGG 2 cut(s) 406, 757
BsmAI GTCTC 3 cut(s) 200, 374, 801
BsmI GAATGC 1 cut(s) 596
BsnI GGCC 1 cut(s) 699
Bso31I GGTCTC 2 cut(s) 200, 374
Bsp1407I TGTACA 1 cut(s) 568
Bsp143I GATC 2 cut(s) 487, 542
BspACI CCGC 6 cut(s) 340, 400, 594, 887, 911, 918
BspANI GGCC 1 cut(s) 699
BspCNI CTCAG 2 cut(s) 631, 811
BspFNI CGCG 1 cut(s) 887
BspHI TCATGA 1 cut(s) 510
BspPI GGATC 1 cut(s) 482
BspQI GCTCTTC 2 cut(s) 188, 459
BspTI CTTAAG 1 cut(s) 850
BspTNI GGTCTC 2 cut(s) 200, 374
BsrBI CCGCTC 1 cut(s) 920
BsrDI GCAATG 2 cut(s) 453, 752
BsrGI TGTACA 1 cut(s) 568
BsrI ACTGG 4 cut(s) 671, 751, 807, 819
BssECI CCNNGG 1 cut(s) 152
BssMI GATC 2 cut(s) 487, 542
Bst2UI CCWGG 1 cut(s) 153
Bst4CI ACNGT 2 cut(s) 223, 795
Bst6I CTCTTC 4 cut(s) 36, 188, 198, 459
BstAFI CTTAAG 1 cut(s) 850
BstAUI TGTACA 1 cut(s) 568
BstC8I GCNNGC 2 cut(s) 697, 847
BstDEI CTNAG 3 cut(s) 306, 618, 798
BstF5I GGATG 2 cut(s) 163, 709
BstFNI CGCG 1 cut(s) 887
BstKTI GATC 2 cut(s) 490, 545
BstMAI GTCTC 3 cut(s) 200, 374, 801
BstMBI GATC 2 cut(s) 487, 542
BstMWI GCNNNNNNNGC 3 cut(s) 348, 908, 917
BstNI CCWGG 1 cut(s) 153
BstNSI RCATGY 1 cut(s) 129
BstSCI CCNGG 1 cut(s) 151
BstSFI CTRYAG 1 cut(s) 791
BstUI CGCG 1 cut(s) 887
BstV1I GCAGC 5 cut(s) 251, 452, 455, 483, 486
BstV2I GAAGAC 1 cut(s) 403
BstXI CCANNNNNNTGG 1 cut(s) 814
BsuRI GGCC 1 cut(s) 699
BtsCI GGATG 2 cut(s) 163, 709
BtsIMutI CAGTG 2 cut(s) 219, 626
Cac8I GCNNGC 2 cut(s) 697, 847
CaiI CAGNNNCTG 1 cut(s) 757
CciI TCATGA 1 cut(s) 510
CseI GACGC 1 cut(s) 458
Csp6I GTAC 2 cut(s) 224, 569
CviAII CATG 4 cut(s) 122, 126, 473, 511
CviJI RGCY 9 cut(s) 198, 242, 305, 496, 575, 695, 699, 790, 870
CviKI_1 RGCY 9 cut(s) 198, 242, 305, 496, 575, 695, 699, 790, 870
CviQI GTAC 2 cut(s) 224, 569
DdeI CTNAG 3 cut(s) 306, 618, 798
DpnI GATC 2 cut(s) 489, 544
DpnII GATC 2 cut(s) 487, 542
DraIII CACNNNGTG 1 cut(s) 377
EaeI YGGCCR 1 cut(s) 697
Eam1104I CTCTTC 4 cut(s) 36, 188, 198, 459
EarI CTCTTC 4 cut(s) 36, 188, 198, 459
EciI GGCGGA 1 cut(s) 926
Eco31I GGTCTC 2 cut(s) 200, 374
Eco32I GATATC 1 cut(s) 80
Eco57I CTGAAG 1 cut(s) 123
EcoRI GAATTC 1 cut(s) 432
EcoRII CCWGG 1 cut(s) 151
EcoRV GATATC 1 cut(s) 80
EcoT22I ATGCAT 1 cut(s) 127
FaeI CATG 4 cut(s) 125, 129, 476, 514
FalI AAGNNNNNCTT 2 cut(s) 182, 214
FatI CATG 4 cut(s) 121, 125, 472, 510
Fnu4HI GCNGC 6 cut(s) 240, 441, 444, 497, 500, 594
FokI GGATG 2 cut(s) 170, 696
Fsp4HI GCNGC 6 cut(s) 240, 441, 444, 497, 500, 594
GluI GCNGC 6 cut(s) 240, 441, 444, 497, 500, 594
GsuI CTGGAG 1 cut(s) 790
HaeIII GGCC 1 cut(s) 699
HgaI GACGC 1 cut(s) 458
Hin1II CATG 4 cut(s) 125, 129, 476, 514
HincII GTYRAC 2 cut(s) 642, 812
HindII GTYRAC 2 cut(s) 642, 812
HinfI GANTC 3 cut(s) 321, 635, 914
HphI GGTGA 5 cut(s) 43, 88, 389, 673, 733
Hpy166II GTNNAC 4 cut(s) 96, 642, 664, 812
Hpy188I TCNGA 5 cut(s) 54, 103, 657, 801, 860
Hpy188III TCNNGA 4 cut(s) 83, 335, 511, 824
Hpy8I GTNNAC 4 cut(s) 96, 642, 664, 812
HpyAV CCTTC 3 cut(s) 17, 68, 652
HpyCH4III ACNGT 2 cut(s) 223, 795
HpyCH4IV ACGT 1 cut(s) 417
HpyCH4V TGCA 7 cut(s) 4, 125, 424, 502, 672, 679, 745
HpyF10VI GCNNNNNNNGC 3 cut(s) 348, 908, 917
HpyF3I CTNAG 3 cut(s) 306, 618, 798
HpySE526I ACGT 1 cut(s) 417
Hsp92II CATG 4 cut(s) 125, 129, 476, 514
Kzo9I GATC 2 cut(s) 487, 542
LguI GCTCTTC 2 cut(s) 188, 459
LmnI GCTCC 1 cut(s) 180
Lsp1109I GCAGC 5 cut(s) 251, 452, 455, 483, 486
MaeII ACGT 1 cut(s) 417
MalI GATC 2 cut(s) 489, 544
MbiI CCGCTC 1 cut(s) 920
MboI GATC 2 cut(s) 487, 542
MboII GAAGA 8 cut(s) 53, 116, 205, 215, 403, 476, 596, 606
MlsI TGGCCA 1 cut(s) 699
MluCI AATT 7 cut(s) 185, 214, 289, 432, 528, 728, 776
MluNI TGGCCA 1 cut(s) 699
MlyI GAGTC 1 cut(s) 629
MnlI CCTC 6 cut(s) 37, 57, 109, 258, 394, 856
Mox20I TGGCCA 1 cut(s) 699
Mph1103I ATGCAT 1 cut(s) 127
MscI TGGCCA 1 cut(s) 699
MseI TTAA 8 cut(s) 189, 213, 299, 459, 731, 774, 851, 905
MslI CAYNNNNRTG 2 cut(s) 126, 719
Msp20I TGGCCA 1 cut(s) 699
MspCI CTTAAG 1 cut(s) 850
MspR9I CCNGG 1 cut(s) 153
Mva1269I GAATGC 1 cut(s) 596
MvaI CCWGG 1 cut(s) 153
MvnI CGCG 1 cut(s) 887
MwoI GCNNNNNNNGC 3 cut(s) 348, 908, 917
NdeII GATC 2 cut(s) 487, 542
NlaIII CATG 4 cut(s) 125, 129, 476, 514
NsiI ATGCAT 1 cut(s) 127
NspI RCATGY 1 cut(s) 129
OliI CACNNNNGTG 1 cut(s) 719
PagI TCATGA 1 cut(s) 510
PciSI GCTCTTC 2 cut(s) 188, 459
PctI GAATGC 1 cut(s) 596
PfeI GAWTC 2 cut(s) 321, 914
PflMI CCANNNNNTGG 1 cut(s) 757
PkrI GCNGC 6 cut(s) 241, 442, 445, 498, 501, 595
PleI GAGTC 1 cut(s) 629
PpsI GAGTC 1 cut(s) 629
PshBI ATTAAT 3 cut(s) 213, 459, 731
Psp6I CCWGG 1 cut(s) 151
PspGI CCWGG 1 cut(s) 151
PstNI CAGNNNCTG 1 cut(s) 757
RsaI GTAC 2 cut(s) 225, 570
RsaNI GTAC 2 cut(s) 224, 569
RseI CAYNNNNRTG 2 cut(s) 126, 719
SapI GCTCTTC 2 cut(s) 188, 459
SaqAI TTAA 8 cut(s) 189, 213, 299, 459, 731, 774, 851, 905
SatI GCNGC 6 cut(s) 240, 441, 444, 497, 500, 594
Sau3AI GATC 2 cut(s) 487, 542
SchI GAGTC 1 cut(s) 629
ScrFI CCNGG 1 cut(s) 153
SfcI CTRYAG 1 cut(s) 791
SmiMI CAYNNNNRTG 2 cut(s) 126, 719
SmlI CTYRAG 1 cut(s) 850
SmoI CTYRAG 1 cut(s) 850
Sse9I AATT 7 cut(s) 185, 214, 289, 432, 528, 728, 776
SsiI CCGC 6 cut(s) 340, 400, 594, 887, 911, 918
StyD4I CCNGG 1 cut(s) 151
TaaI ACNGT 2 cut(s) 223, 795
TaiI ACGT 1 cut(s) 420
TaqI TCGA 1 cut(s) 386
TaqII GACCGA 1 cut(s) 659
TasI AATT 7 cut(s) 185, 214, 289, 432, 528, 728, 776
TatI WGTACW 2 cut(s) 223, 568
TauI GCSGC 1 cut(s) 596
TfiI GAWTC 2 cut(s) 321, 914
Tru1I TTAA 8 cut(s) 189, 213, 299, 459, 731, 774, 851, 905
Tru9I TTAA 8 cut(s) 189, 213, 299, 459, 731, 774, 851, 905
TscAI CASTG 2 cut(s) 226, 626
TseI GCWGC 5 cut(s) 239, 440, 443, 496, 499
TspDTI ATGAA 7 cut(s) 36, 128, 267, 477, 573, 779, 917
TspRI CASTG 2 cut(s) 226, 626
Van91I CCANNNNNTGG 1 cut(s) 757
Vha464I CTTAAG 1 cut(s) 850
VspI ATTAAT 3 cut(s) 213, 459, 731
XapI RAATTY 2 cut(s) 185, 432
XceI RCATGY 1 cut(s) 129
Zsp2I ATGCAT 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.