Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002169.1

Orthogroup ID

OG0003312

Physical Location & Seq

Genomic Coordinates Forward (+)

207513 .. 208817

Gene Structure 1305 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002169.1_g000040.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1305 bp

atgcaaacaaacacacttcgatttttcaccttccctctcctctctgtccatctcctccttccttctaacctcgtgattgtgatttcacgtgaagaatcgtctgagtataaactgaaggcgtaccagaataatattactcaaagaggtgaaatgacattgaaaaagaataaggccaaggatggtggcagtggcggtgatctgaagaggttcaccgttgttgataccagtctagtctttggaggaaaatcatcaacagtgagagagataagatgcttgccagctgtagataaatgtgtactcaagtcgaaacgtacttcctgggaaactgaagcaatttcctctgaggatctactgcaaaaaggtaatgctgatgctatagatagttcactgaacggtgaattgaataacttcaatatcaactgccatgaggatacatctgctactacggaaaaagtggagagccaccaggatcagaaaatcagcatgtctgatgacaagcagccaaaggagagtacattgagcaaattcagtcggagagctaaatctagccattcggattccataggccctcttatcaaacggcgaaaattaacttcttgtgttaaggcagagacaagttgcctcattgaaaactgttcgcaagggttggagtcggaacaagtgggactccatggaacattgaccgaactaaattcaggaacgcttgttgttgctctagtgggtcctaaacaaaaggaatcatcaagtacttctgaggctgaaggtagcctagaagaggagagcagtttggaaactcgcagtggagattgttttggcgtgcacacttctcaagtccacacatcatctaacctgagccaacctcaggatttggtggatagaacagatggtgatacatgtgttgagttcagccatgagacaaatgcaaatagttcaggcctttcatctagtggaacaaagcctgctgatgattctcggagaatctctaacatgagttctaggaggcaaagcaccaggaaccgaccgctaaccactaaagcaatggaagctcttgcaaatgggtacttaagtattaaaactagacaaaagaaagatgttggtatgagagaaagctcattgtcacgaccctctcgcaagtcccacaaggtccgcagcagagtcgaagcaacttcaagccctcctgatactgaaggtggaattgtgacttcaaaggaagaaatggaaatcaatgaagcttgcaatgctaacaaagatacagtcaggaaacctcttgatcaaatggcagataagtggctcactagctactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

434

Amino Acids

47.63

Weight (kDa)

7.57

Isoelectric Point (pI)

54.58

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003312)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G09040 AT1G09050 AT1G09050 AT1G55050 AT1G55050
fragaria_vesca	FvH4_6g06260 FvH4_6g06260 FvH4_6g06260 FvH4_6g06260 FvH4_6g06260 FvH4_6g06260 FvH4_6g06260 FvH4_6g06260 FvH4_6g06260 FvH4_6g06260
malus_domestica	MD04G1203200.v1.1 MD12G1216900.v1.1
prunus_persica	Prupe.6G323200_v2.0.a1 Prupe.6G323200_v2.0.a1 Prupe.6G323200_v2.0.a1 Prupe.6G323200_v2.0.a1 Prupe.6G323200_v2.0.a1
pyrus_communis	pycom04g17940 pycom12g20240
rosa_chinensis	RchiOBHm_Chr3g0455281
rosa_laevigata	RLG00000025372
rosa_multiflora	Rmu_sc0002169.1_g000039 Rmu_sc0002169.1_g000040 Rmu_sc0029206.1_g000001
rosa_roxburghii	Rroxscaffold_6G00424400
rosa_rugosa	Rorug03G0005900
rosa_samantha	Rh3AG065700 Rh3BG067900 Rh3CG066300 Rh3DG067900
rosa_wichuraiana	Rw3G005180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	3 cut(s)	192, 1022, 1147
AclWI	GGATC	2 cut(s)	354, 477
AcsI	RAATTY	2 cut(s)	524, 691
AcuI	CTGAAG	5 cut(s)	134, 221, 348, 780, 1206
AcvI	CACGTG	1 cut(s)	89
AfaI	GTAC	6 cut(s)	122, 297, 313, 514, 748, 1061
AfiI	CCNNNNNNNGG	2 cut(s)	775, 862
AflII	CTTAAG	1 cut(s)	1063
AflIII	ACRYGT	1 cut(s)	893
AgsI	TTSAA	6 cut(s)	160, 403, 412, 629, 1170, 1206
AjnI	CCWGG	3 cut(s)	317, 465, 1010
AluBI	AGCT	6 cut(s)	281, 539, 1046, 1110, 1232, 1299
AluI	AGCT	6 cut(s)	281, 539, 1046, 1110, 1232, 1299
Alw21I	GWGCWC	1 cut(s)	822
Alw26I	GTCTC	2 cut(s)	605, 908
Alw44I	GTGCAC	1 cut(s)	818
AlwI	GGATC	2 cut(s)	354, 477
AoxI	GGCC	3 cut(s)	171, 565, 934
ApaLI	GTGCAC	1 cut(s)	818
ApeKI	GCWGC	2 cut(s)	499, 1149
ApoI	RAATTY	2 cut(s)	524, 691
ArsI	GACNNNNNNTTYG	2 cut(s)	1239, 1271
Asp700I	GAANNNNTTC	2 cut(s)	206, 407
AspS9I	GGNCC	3 cut(s)	566, 722, 1144
AsuHPI	GGTGA	6 cut(s)	19, 158, 202, 206, 407, 899
AvaII	GGWCC	2 cut(s)	722, 1144
AxyI	CCTNAGG	1 cut(s)	861
BaeGI	GKGCMC	1 cut(s)	822
BaeI	ACNNNNGTAYC	4 cut(s)	882, 915, 1051, 1084
BauI	CACGAG	1 cut(s)	71
BbrPI	CACGTG	1 cut(s)	89
Bbv12I	GWGCWC	1 cut(s)	822
BbvI	GCAGC	2 cut(s)	511, 1161
BccI	CCATC	3 cut(s)	57, 173, 878
BceAI	ACGGC	1 cut(s)	596
BcgI	CGANNNNNNTGC	2 cut(s)	1138, 1172
BciT130I	CCWGG	3 cut(s)	319, 467, 1012
BciVI	GTATCC	1 cut(s)	424
BclI	TGATCA	1 cut(s)	1270
BcoDI	GTCTC	2 cut(s)	605, 908
BfaI	CTAG	9 cut(s)	230, 546, 716, 770, 945, 996, 1077, 1296, 1303
BfmI	CTRYAG	2 cut(s)	282, 375
BfrI	CTTAAG	1 cut(s)	1063
BfuI	GTATCC	1 cut(s)	424
BisI	GCNGC	2 cut(s)	500, 1150
BlsI	GCNGC	2 cut(s)	501, 1151
BmcAI	AGTACT	1 cut(s)	748
Bme1390I	CCNGG	3 cut(s)	319, 467, 1012
Bme18I	GGWCC	2 cut(s)	722, 1144
BmgT120I	GGNCC	3 cut(s)	566, 722, 1144
BmiI	GGNNCC	2 cut(s)	723, 1016
BmrFI	CCNGG	3 cut(s)	319, 467, 1012
BmsI	GCATC	2 cut(s)	260, 361
BplI	GAGNNNNNCTC	2 cut(s)	844, 876
Bpu10I	CCTNAGC	1 cut(s)	851
BpuEI	CTTGAG	2 cut(s)	284, 813
BsaAI	YACGTR	1 cut(s)	89
BsaJI	CCNNGG	3 cut(s)	174, 318, 670
Bsc4I	CCNNNNNNNGG	2 cut(s)	775, 862
Bse1I	ACTGG	1 cut(s)	225
Bse21I	CCTNAGG	1 cut(s)	861
Bse3DI	GCAATG	2 cut(s)	1044, 1243
BseBI	CCWGG	3 cut(s)	319, 467, 1012
BseDI	CCNNGG	3 cut(s)	174, 318, 670
BseGI	GGATG	1 cut(s)	184
BseLI	CCNNNNNNNGG	2 cut(s)	775, 862
BseMI	GCAATG	2 cut(s)	1044, 1243
BseMII	CTCAG	5 cut(s)	93, 333, 744, 842, 875
BseNI	ACTGG	1 cut(s)	225
BseRI	GAGGAG	3 cut(s)	29, 44, 791
BseSI	GKGCMC	1 cut(s)	822
BseXI	GCAGC	2 cut(s)	511, 1161
Bsh1285I	CGRYCG	1 cut(s)	1022
BshFI	GGCC	3 cut(s)	173, 567, 936
BsiEI	CGRYCG	1 cut(s)	1022
BsiHKAI	GWGCWC	1 cut(s)	822
BslFI	GGGAC	2 cut(s)	678, 1120
BslI	CCNNNNNNNGG	2 cut(s)	775, 862
BsmAI	GTCTC	2 cut(s)	605, 908
BsmFI	GGGAC	2 cut(s)	678, 1120
BsnI	GGCC	3 cut(s)	173, 567, 936
Bsp1286I	GDGCHC	1 cut(s)	822
Bsp143I	GATC	4 cut(s)	196, 346, 469, 1270
Bsp19I	CCATGG	1 cut(s)	670
BspACI	CCGC	3 cut(s)	192, 1022, 1147
BspANI	GGCC	3 cut(s)	173, 567, 936
BspCNI	CTCAG	5 cut(s)	94, 334, 745, 843, 874
BspLI	GGNNCC	2 cut(s)	723, 1016
BspPI	GGATC	2 cut(s)	354, 477
BspTI	CTTAAG	1 cut(s)	1063
BsrDI	GCAATG	2 cut(s)	1044, 1243
BsrI	ACTGG	1 cut(s)	225
BssECI	CCNNGG	3 cut(s)	174, 318, 670
BssMI	GATC	4 cut(s)	196, 346, 469, 1270
BssSI	CACGAG	1 cut(s)	71
BssT1I	CCWWGG	2 cut(s)	174, 670
Bst2BI	CACGAG	1 cut(s)	71
Bst2UI	CCWGG	3 cut(s)	319, 467, 1012
Bst4CI	ACNGT	5 cut(s)	214, 256, 395, 635, 1255
Bst6I	CTCTTC	2 cut(s)	197, 768
BstAFI	CTTAAG	1 cut(s)	1063
BstBAI	YACGTR	1 cut(s)	89
BstC8I	GCNNGC	5 cut(s)	275, 279, 818, 960, 1234
BstDEI	CTNAG	5 cut(s)	102, 342, 753, 851, 861
BstDSI	CCRYGG	1 cut(s)	670
BstENI	CCTNNNNNAGG	1 cut(s)	773
BstF5I	GGATG	1 cut(s)	184
BstKTI	GATC	4 cut(s)	199, 349, 472, 1273
BstMAI	GTCTC	2 cut(s)	605, 908
BstMBI	GATC	4 cut(s)	196, 346, 469, 1270
BstMCI	CGRYCG	1 cut(s)	1022
BstMWI	GCNNNNNNNGC	2 cut(s)	1043, 1238
BstNI	CCWGG	3 cut(s)	319, 467, 1012
BstNSI	RCATGY	2 cut(s)	487, 897
BstSCI	CCNGG	3 cut(s)	317, 465, 1010
BstSFI	CTRYAG	2 cut(s)	282, 375
BstSLI	GKGCMC	1 cut(s)	822
BstV1I	GCAGC	2 cut(s)	511, 1161
BstX2I	RGATCY	1 cut(s)	346
BstYI	RGATCY	1 cut(s)	346
Bsu36I	CCTNAGG	1 cut(s)	861
BsuI	GTATCC	1 cut(s)	424
BsuRI	GGCC	3 cut(s)	173, 567, 936
BtgI	CCRYGG	1 cut(s)	670
BtsCI	GGATG	1 cut(s)	184
BtsI	GCAGTG	2 cut(s)	193, 805
BtsIMutI	CAGTG	4 cut(s)	193, 261, 386, 805
Cac8I	GCNNGC	5 cut(s)	275, 279, 818, 960, 1234
Cfr13I	GGNCC	3 cut(s)	566, 722, 1144
Csp6I	GTAC	6 cut(s)	121, 296, 312, 513, 747, 1060
CspCI	CAANNNNNGTGG	2 cut(s)	163, 198
CviAII	CATG	6 cut(s)	425, 484, 671, 894, 911, 988
CviQI	GTAC	6 cut(s)	121, 296, 312, 513, 747, 1060
DdeI	CTNAG	5 cut(s)	102, 342, 753, 851, 861
DpnI	GATC	4 cut(s)	198, 348, 471, 1272
DpnII	GATC	4 cut(s)	196, 346, 469, 1270
Eam1104I	CTCTTC	2 cut(s)	197, 768
EarI	CTCTTC	2 cut(s)	197, 768
Eco130I	CCWWGG	2 cut(s)	174, 670
Eco147I	AGGCCT	1 cut(s)	936
Eco47I	GGWCC	2 cut(s)	722, 1144
Eco57I	CTGAAG	5 cut(s)	134, 221, 348, 780, 1206
Eco72I	CACGTG	1 cut(s)	89
Eco81I	CCTNAGG	1 cut(s)	861
EcoNI	CCTNNNNNAGG	1 cut(s)	773
EcoO109I	RGGNCCY	2 cut(s)	566, 722
EcoRII	CCWGG	3 cut(s)	317, 465, 1010
EcoT14I	CCWWGG	2 cut(s)	174, 670
ErhI	CCWWGG	2 cut(s)	174, 670
FaeI	CATG	6 cut(s)	428, 487, 674, 897, 914, 991
FaqI	GGGAC	2 cut(s)	678, 1120
FatI	CATG	6 cut(s)	424, 483, 670, 893, 910, 987
FbaI	TGATCA	1 cut(s)	1270
Fnu4HI	GCNGC	2 cut(s)	500, 1150
FokI	GGATG	1 cut(s)	191
Fsp4HI	GCNGC	2 cut(s)	500, 1150
FspBI	CTAG	9 cut(s)	230, 546, 716, 770, 945, 996, 1077, 1296, 1303
GluI	GCNGC	2 cut(s)	500, 1150
HaeIII	GGCC	3 cut(s)	173, 567, 936
Hin1II	CATG	6 cut(s)	428, 487, 674, 897, 914, 991
HindIII	AAGCTT	1 cut(s)	1230
HinfI	GANTC	8 cut(s)	95, 557, 650, 666, 737, 968, 978, 1155
HphI	GGTGA	6 cut(s)	19, 158, 202, 206, 407, 899
Hpy166II	GTNNAC	5 cut(s)	210, 296, 386, 820, 835
Hpy188III	TCNNGA	7 cut(s)	73, 696, 863, 1119, 1178, 1258, 1268
Hpy8I	GTNNAC	5 cut(s)	210, 296, 386, 820, 835
HpyAV	CCTTC	6 cut(s)	40, 68, 72, 109, 755, 1181
HpyCH4III	ACNGT	5 cut(s)	214, 256, 395, 635, 1255
HpyCH4IV	ACGT	2 cut(s)	88, 310
HpyCH4V	TGCA	6 cut(s)	4, 355, 820, 923, 1052, 1236
HpyF10VI	GCNNNNNNNGC	2 cut(s)	1043, 1238
HpyF3I	CTNAG	5 cut(s)	102, 342, 753, 851, 861
HpySE526I	ACGT	2 cut(s)	88, 310
Hsp92II	CATG	6 cut(s)	428, 487, 674, 897, 914, 991
Ksp22I	TGATCA	1 cut(s)	1270
Kzo9I	GATC	4 cut(s)	196, 346, 469, 1270
Lsp1109I	GCAGC	2 cut(s)	511, 1161
LweI	GCATC	2 cut(s)	260, 361
MaeI	CTAG	9 cut(s)	230, 546, 716, 770, 945, 996, 1077, 1296, 1303
MaeII	ACGT	2 cut(s)	88, 310
MaeIII	GTNAC	2 cut(s)	1116, 1198
MalI	GATC	4 cut(s)	198, 348, 471, 1272
MboI	GATC	4 cut(s)	196, 346, 469, 1270
MboII	GAAGA	4 cut(s)	104, 214, 785, 1223
MflI	RGATCY	1 cut(s)	346
MhlI	GDGCHC	1 cut(s)	822
MluCI	AATT	6 cut(s)	333, 398, 524, 587, 691, 1194
MlyI	GAGTC	3 cut(s)	659, 660, 1164
MmeI	TCCRAC	3 cut(s)	512, 627, 633
MroXI	GAANNNNTTC	2 cut(s)	206, 407
MseI	TTAA	4 cut(s)	590, 603, 1064, 1071
MspA1I	CMGCKG	1 cut(s)	281
MspCI	CTTAAG	1 cut(s)	1063
MspR9I	CCNGG	3 cut(s)	319, 467, 1012
MvaI	CCWGG	3 cut(s)	319, 467, 1012
MwoI	GCNNNNNNNGC	2 cut(s)	1043, 1238
NcoI	CCATGG	1 cut(s)	670
NdeII	GATC	4 cut(s)	196, 346, 469, 1270
NlaIII	CATG	6 cut(s)	428, 487, 674, 897, 914, 991
NlaIV	GGNNCC	2 cut(s)	723, 1016
NmuCI	GTSAC	2 cut(s)	1116, 1198
NspI	RCATGY	2 cut(s)	487, 897
PceI	AGGCCT	1 cut(s)	936
PciI	ACATGT	1 cut(s)	893
PdmI	GAANNNNTTC	2 cut(s)	206, 407
PfeI	GAWTC	5 cut(s)	95, 557, 737, 968, 978
PkrI	GCNGC	2 cut(s)	501, 1151
PleI	GAGTC	3 cut(s)	658, 660, 1163
PmaCI	CACGTG	1 cut(s)	89
PmlI	CACGTG	1 cut(s)	89
PpsI	GAGTC	3 cut(s)	658, 660, 1163
Ppu21I	YACGTR	1 cut(s)	89
PpuMI	RGGWCCY	1 cut(s)	722
PscI	ACATGT	1 cut(s)	893
Psp5II	RGGWCCY	1 cut(s)	722
Psp6I	CCWGG	3 cut(s)	317, 465, 1010
PspCI	CACGTG	1 cut(s)	89
PspGI	CCWGG	3 cut(s)	317, 465, 1010
PspN4I	GGNNCC	2 cut(s)	723, 1016
PspPI	GGNCC	3 cut(s)	566, 722, 1144
PspPPI	RGGWCCY	1 cut(s)	722
PsuI	RGATCY	1 cut(s)	346
PvuII	CAGCTG	1 cut(s)	281
RsaI	GTAC	6 cut(s)	122, 297, 313, 514, 748, 1061
RsaNI	GTAC	6 cut(s)	121, 296, 312, 513, 747, 1060
SaqAI	TTAA	4 cut(s)	590, 603, 1064, 1071
SatI	GCNGC	2 cut(s)	500, 1150
Sau3AI	GATC	4 cut(s)	196, 346, 469, 1270
Sau96I	GGNCC	3 cut(s)	566, 722, 1144
ScaI	AGTACT	1 cut(s)	748
SchI	GAGTC	3 cut(s)	659, 660, 1164
ScrFI	CCNGG	3 cut(s)	319, 467, 1012
SduI	GDGCHC	1 cut(s)	822
SfaNI	GCATC	2 cut(s)	260, 361
SfcI	CTRYAG	2 cut(s)	282, 375
SinI	GGWCC	2 cut(s)	722, 1144
SmlI	CTYRAG	3 cut(s)	299, 828, 1063
SmoI	CTYRAG	3 cut(s)	299, 828, 1063
Sse9I	AATT	6 cut(s)	333, 398, 524, 587, 691, 1194
SseBI	AGGCCT	1 cut(s)	936
SsiI	CCGC	3 cut(s)	192, 1022, 1147
SspI	AATATT	1 cut(s)	133
SspMI	CTAG	9 cut(s)	230, 546, 716, 770, 945, 996, 1077, 1296, 1303
StuI	AGGCCT	1 cut(s)	936
StyD4I	CCNGG	3 cut(s)	317, 465, 1010
StyI	CCWWGG	2 cut(s)	174, 670
TaaI	ACNGT	5 cut(s)	214, 256, 395, 635, 1255
TaiI	ACGT	2 cut(s)	91, 313
TaqI	TCGA	3 cut(s)	19, 305, 1158
TaqII	GACCGA	1 cut(s)	698
TasI	AATT	6 cut(s)	333, 398, 524, 587, 691, 1194
TatI	WGTACW	3 cut(s)	295, 512, 746
TfiI	GAWTC	5 cut(s)	95, 557, 737, 968, 978
Tru1I	TTAA	4 cut(s)	590, 603, 1064, 1071
Tru9I	TTAA	4 cut(s)	590, 603, 1064, 1071
TscAI	CASTG	4 cut(s)	193, 261, 393, 805
TseFI	GTSAC	2 cut(s)	1116, 1198
TseI	GCWGC	2 cut(s)	499, 1149
Tsp45I	GTSAC	2 cut(s)	1116, 1198
TspDTI	ATGAA	2 cut(s)	930, 1242
TspGWI	ACGGA	1 cut(s)	461
TspRI	CASTG	4 cut(s)	193, 261, 393, 805
Vha464I	CTTAAG	1 cut(s)	1063
VneI	GTGCAC	1 cut(s)	818
VpaK11BI	GGWCC	2 cut(s)	722, 1144
XagI	CCTNNNNNAGG	1 cut(s)	773
XapI	RAATTY	2 cut(s)	524, 691
XceI	RCATGY	2 cut(s)	487, 897
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1036
XmnI	GAANNNNTTC	2 cut(s)	206, 407
XspI	CTAG	9 cut(s)	230, 546, 716, 770, 945, 996, 1077, 1296, 1303
ZrmI	AGTACT	1 cut(s)	748

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.