Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002324.1

Orthogroup ID

OG0018139

Physical Location & Seq

Genomic Coordinates Forward (+)

128148 .. 128741

Gene Structure 594 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002324.1_g000028.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 231 bp

atgcttccagctggcgtcgccggacgttgtctggccaagaagatggtagctgctgtagttttggacaagaaagttaattatgatgtacttgttgtggggtctgtttatggcggttatgttgctgcttgtcggctagctatggcaggtgtaagggatggagaaccagacctaggtgttagctatggaccaaaagatgctttgtttaaggttaatctcgaaattaagccatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

GMC_oxred_C GMC_oxred_N

Protein Analysis

76

Amino Acids

7.94

Weight (kDa)

9.0

Isoelectric Point (pI)

24.09

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018139)

Species	Orthologous Gene IDs
pyrus_communis	pycom10g15180 pycom10g15190
rosa_chinensis	RchiOBHm_Chr3g0474671
rosa_multiflora	Rmu_sc0001353.1_g000047 Rmu_sc0002324.1_g000028
rosa_roxburghii	Rroxscaffold_6G00407000
rosa_rugosa	Rorug03G0142000
rosa_samantha	Rh3AG192800 Rh3BG222700 Rh3CG217400 Rh3DG218300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	134
Acc36I	ACCTGC	1 cut(s)	134
AciI	CCGC	1 cut(s)	111
AcoI	YGGCCR	1 cut(s)	33
AcyI	GRCGYC	1 cut(s)	15
AfaI	GTAC	1 cut(s)	87
AfiI	CCNNNNNNNGG	1 cut(s)	170
AluBI	AGCT	4 cut(s)	11, 50, 137, 180
AluI	AGCT	4 cut(s)	11, 50, 137, 180
AoxI	GGCC	1 cut(s)	33
ApeKI	GCWGC	2 cut(s)	50, 122
AspA2I	CCTAGG	1 cut(s)	169
AspS9I	GGNCC	1 cut(s)	185
AsuNHI	GCTAGC	1 cut(s)	133
AvaII	GGWCC	1 cut(s)	185
AvrII	CCTAGG	1 cut(s)	169
BalI	TGGCCA	1 cut(s)	35
BbvI	GCAGC	2 cut(s)	37, 109
BccI	CCATC	2 cut(s)	37, 149
BfaI	CTAG	2 cut(s)	134, 170
BfmI	CTRYAG	1 cut(s)	54
BfuAI	ACCTGC	1 cut(s)	134
BisI	GCNGC	2 cut(s)	51, 123
BlnI	CCTAGG	1 cut(s)	169
BlsI	GCNGC	2 cut(s)	52, 124
Bme18I	GGWCC	1 cut(s)	185
BmgT120I	GGNCC	1 cut(s)	185
BmsI	GCATC	1 cut(s)	184
BmtI	GCTAGC	1 cut(s)	137
BsaHI	GRCGYC	1 cut(s)	15
BsaJI	CCNNGG	1 cut(s)	169
Bsc4I	CCNNNNNNNGG	1 cut(s)	170
BseDI	CCNNGG	1 cut(s)	169
BseGI	GGATG	1 cut(s)	160
BseLI	CCNNNNNNNGG	1 cut(s)	170
BseXI	GCAGC	2 cut(s)	37, 109
BshFI	GGCC	1 cut(s)	35
BsiSI	CCGG	1 cut(s)	21
BslI	CCNNNNNNNGG	1 cut(s)	170
BsnI	GGCC	1 cut(s)	35
BspACI	CCGC	1 cut(s)	111
BspANI	GGCC	1 cut(s)	35
BspMI	ACCTGC	1 cut(s)	134
BspOI	GCTAGC	1 cut(s)	137
BssECI	CCNNGG	1 cut(s)	169
BssNI	GRCGYC	1 cut(s)	15
BssT1I	CCWWGG	1 cut(s)	169
BstACI	GRCGYC	1 cut(s)	15
BstC8I	GCNNGC	2 cut(s)	13, 135
BstF5I	GGATG	1 cut(s)	160
BstMWI	GCNNNNNNNGC	1 cut(s)	17
BstSFI	CTRYAG	1 cut(s)	54
BstV1I	GCAGC	2 cut(s)	37, 109
BstXI	CCANNNNNNTGG	1 cut(s)	43
BsuRI	GGCC	1 cut(s)	35
BtsCI	GGATG	1 cut(s)	160
BveI	ACCTGC	1 cut(s)	134
Cac8I	GCNNGC	2 cut(s)	13, 135
Cfr13I	GGNCC	1 cut(s)	185
CseI	GACGC	1 cut(s)	4
Csp6I	GTAC	1 cut(s)	86
CviJI	RGCY	7 cut(s)	11, 35, 50, 133, 137, 180, 226
CviKI_1	RGCY	7 cut(s)	11, 35, 50, 133, 137, 180, 226
CviQI	GTAC	1 cut(s)	86
EaeI	YGGCCR	1 cut(s)	33
Eco130I	CCWWGG	1 cut(s)	169
Eco47I	GGWCC	1 cut(s)	185
EcoT14I	CCWWGG	1 cut(s)	169
ErhI	CCWWGG	1 cut(s)	169
FaiI	YATR	6 cut(s)	81, 108, 117, 140, 183, 229
Fnu4HI	GCNGC	2 cut(s)	51, 123
FokI	GGATG	1 cut(s)	167
Fsp4HI	GCNGC	2 cut(s)	51, 123
FspBI	CTAG	2 cut(s)	134, 170
GluI	GCNGC	2 cut(s)	51, 123
HaeIII	GGCC	1 cut(s)	35
HapII	CCGG	1 cut(s)	21
HgaI	GACGC	1 cut(s)	4
Hin1I	GRCGYC	1 cut(s)	15
HpaII	CCGG	1 cut(s)	21
Hpy188III	TCNNGA	1 cut(s)	215
Hpy99I	CGWCG	1 cut(s)	20
HpyCH4IV	ACGT	1 cut(s)	25
HpyF10VI	GCNNNNNNNGC	1 cut(s)	17
HpySE526I	ACGT	1 cut(s)	25
Hsp92I	GRCGYC	1 cut(s)	15
LpnPI	CCDG	5 cut(s)	17, 21, 34, 129, 177
Lsp1109I	GCAGC	2 cut(s)	37, 109
LweI	GCATC	1 cut(s)	184
MaeI	CTAG	2 cut(s)	134, 170
MaeII	ACGT	1 cut(s)	25
MboII	GAAGA	1 cut(s)	52
MlsI	TGGCCA	1 cut(s)	35
MluCI	AATT	2 cut(s)	76, 219
MluNI	TGGCCA	1 cut(s)	35
Mox20I	TGGCCA	1 cut(s)	35
MscI	TGGCCA	1 cut(s)	35
MseI	TTAA	4 cut(s)	75, 204, 210, 222
Msp20I	TGGCCA	1 cut(s)	35
MspA1I	CMGCKG	1 cut(s)	11
MspI	CCGG	1 cut(s)	21
MwoI	GCNNNNNNNGC	1 cut(s)	17
NheI	GCTAGC	1 cut(s)	133
PaqCI	CACCTGC	1 cut(s)	134
PflFI	GACNNNGTC	1 cut(s)	27
PkrI	GCNGC	2 cut(s)	52, 124
PspPI	GGNCC	1 cut(s)	185
PsyI	GACNNNGTC	1 cut(s)	27
PvuII	CAGCTG	1 cut(s)	11
RsaI	GTAC	1 cut(s)	87
RsaNI	GTAC	1 cut(s)	86
SaqAI	TTAA	4 cut(s)	75, 204, 210, 222
SatI	GCNGC	2 cut(s)	51, 123
Sau96I	GGNCC	1 cut(s)	185
SetI	ASST	9 cut(s)	13, 28, 52, 139, 148, 171, 175, 182, 210
SfaNI	GCATC	1 cut(s)	184
SfcI	CTRYAG	1 cut(s)	54
SinI	GGWCC	1 cut(s)	185
Sse9I	AATT	2 cut(s)	76, 219
SsiI	CCGC	1 cut(s)	111
SspMI	CTAG	2 cut(s)	134, 170
StyI	CCWWGG	1 cut(s)	169
TaiI	ACGT	1 cut(s)	28
TaqI	TCGA	1 cut(s)	216
TasI	AATT	2 cut(s)	76, 219
TatI	WGTACW	1 cut(s)	85
Tru1I	TTAA	4 cut(s)	75, 204, 210, 222
Tru9I	TTAA	4 cut(s)	75, 204, 210, 222
TseI	GCWGC	2 cut(s)	50, 122
Tth111I	GACNNNGTC	1 cut(s)	27
VpaK11BI	GGWCC	1 cut(s)	185
XmaJI	CCTAGG	1 cut(s)	169
XspI	CTAG	2 cut(s)	134, 170

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.