Rh3CG217400

GMC oxidoreductase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0018139
Physical Location & Seq
Reverse (-)
20130154 .. 20175766
45613 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG217400.1

Sequence Viewer

Length: 723 bp
ATGGAGGAGCAAGCAGAGGTAGAAAGCAGTTTTGGACATGAAAGTTATGATGCAGTTGTTGTGGGGTCTGGTTATGGCGGTTCTGTTGCTGCTTGTCGGCTGGCTATGGCAGGCGTAAGGGTGTGTCTACTTGAAAAAGGCCGAAAATGGGAAGCGCAGGACTTCCCAACTGACAGCTTCAAAATCTTATCGGCTGTGAGGATGGAGAACCAGAACCTAGGTGTTAGCTATGGACCAAAAGACGCTTTATTTCAGGTGTACGAGCAAAATGATTCTCTAGCAGCAGTGGCTTGTGGGCTTGGTGGAGGTTCACTAGTGAATGCTGGAGTTATGATGCCAGCACCTGTTCGTGCTAGACGGCATCCAAAATGGCCGAAGGAATGGGAAAGGAATTGGGGTAGTTGTGAAGCTTCTGCTGCAGACATGCTGAGAATACAAAGCATTCCCGTCAAGTTTCCTTCCGCGAAAATTTTGGAAGAAGCTGCTGATGGAGTGACTGTTGACACTTCAATAAAGCTTAGTGTGAATTTTGACATTGAAGAACCAACAACAAATGGAACGAAGCGTCCACAGATGGGTAGCTGCTTAGCCTGTGGAAACTGTCTTTCTGGATGTCCATATAACGCCAAAAGTTCCACTGACAAAAATTATCTTGTCTCAGCAATCCAGGGAGGATGCACTGTTAAAACAGAATGTGAAGTATGTAGTGAGGGACATGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GMC_oxred_C GMC_oxred_N

Protein Analysis

240

Amino Acids

25.67

Weight (kDa)

5.21

Isoelectric Point (pI)

49.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GMC_oxred_N PF00732 17 - 234 8.4e-09 GMC oxidoreductase
NAD_binding_8 PF13450 20 - 48 6.8e-06 NAD(P)-binding Rossmann-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018139)

Species Orthologous Gene IDs
pyrus_communis pycom10g15180 pycom10g15190
rosa_chinensis RchiOBHm_Chr3g0474671
rosa_multiflora Rmu_sc0001353.1_g000047 Rmu_sc0002324.1_g000028
rosa_roxburghii Rroxscaffold_6G00407000
rosa_rugosa Rorug03G0142000
rosa_samantha Rh3AG192800 Rh3BG222700 Rh3CG217400 Rh3DG218300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 127
AccII CGCG 1 cut(s) 464
AciI CCGC 2 cut(s) 78, 462
AcoI YGGCCR 1 cut(s) 371
AcsI RAATTY 2 cut(s) 468, 526
AfaI GTAC 1 cut(s) 260
AfiI CCNNNNNNNGG 2 cut(s) 148, 575
AflIII ACRYGT 1 cut(s) 715
AgsI TTSAA 4 cut(s) 134, 181, 510, 539
AhlI ACTAGT 1 cut(s) 313
AjnI CCWGG 1 cut(s) 666
AjuI GAANNNNNNNTTGG 2 cut(s) 15, 47
AloI GAACNNNNNNTCC 2 cut(s) 550, 582
AluBI AGCT 6 cut(s) 177, 228, 410, 482, 517, 582
AluI AGCT 6 cut(s) 177, 228, 410, 482, 517, 582
Alw26I GTCTC 1 cut(s) 661
AlwNI CAGNNNCTG 1 cut(s) 344
AoxI GGCC 2 cut(s) 139, 371
ApeKI GCWGC 5 cut(s) 89, 281, 416, 482, 582
ApoI RAATTY 2 cut(s) 468, 526
AspA2I CCTAGG 1 cut(s) 217
AspLEI GCGC 1 cut(s) 157
AspS9I GGNCC 1 cut(s) 233
AvaII GGWCC 1 cut(s) 233
AvrII CCTAGG 1 cut(s) 217
BbvI GCAGC 5 cut(s) 76, 293, 403, 469, 569
BccI CCATC 3 cut(s) 196, 482, 568
BceAI ACGGC 1 cut(s) 374
BciT130I CCWGG 1 cut(s) 668
BcoDI GTCTC 1 cut(s) 661
BcuI ACTAGT 1 cut(s) 313
BfaI CTAG 4 cut(s) 218, 278, 314, 354
BfmI CTRYAG 1 cut(s) 417
BisI GCNGC 5 cut(s) 90, 282, 417, 483, 583
BlnI CCTAGG 1 cut(s) 217
BlpI GCTNAGC 1 cut(s) 586
BlsI GCNGC 5 cut(s) 91, 283, 418, 484, 584
Bme1390I CCNGG 1 cut(s) 668
Bme18I GGWCC 1 cut(s) 233
BmgT120I GGNCC 1 cut(s) 233
BmrFI CCNGG 1 cut(s) 668
BmsI GCATC 4 cut(s) 40, 324, 370, 665
BpmI CTGGAG 1 cut(s) 345
Bpu1102I GCTNAGC 1 cut(s) 586
BsaJI CCNNGG 2 cut(s) 217, 667
BsaXI ACNNNNNCTCC 2 cut(s) 483, 513
Bsc4I CCNNNNNNNGG 2 cut(s) 148, 575
BseBI CCWGG 1 cut(s) 668
BseDI CCNNGG 2 cut(s) 217, 667
BseGI GGATG 4 cut(s) 207, 361, 617, 680
BseLI CCNNNNNNNGG 2 cut(s) 148, 575
BseMII CTCAG 2 cut(s) 419, 672
BseRI GAGGAG 1 cut(s) 20
BseXI GCAGC 5 cut(s) 76, 293, 403, 469, 569
Bsh1236I CGCG 1 cut(s) 464
BshFI GGCC 2 cut(s) 141, 373
BslI CCNNNNNNNGG 2 cut(s) 148, 575
BsmAI GTCTC 1 cut(s) 661
BsmI GAATGC 2 cut(s) 325, 441
BsnI GGCC 2 cut(s) 141, 373
Bsp1720I GCTNAGC 1 cut(s) 586
BspACI CCGC 2 cut(s) 78, 462
BspANI GGCC 2 cut(s) 141, 373
BspCNI CTCAG 2 cut(s) 420, 671
BspFNI CGCG 1 cut(s) 464
BspMAI CTGCAG 1 cut(s) 421
BssECI CCNNGG 2 cut(s) 217, 667
BssT1I CCWWGG 1 cut(s) 217
Bst2UI CCWGG 1 cut(s) 668
Bst4CI ACNGT 3 cut(s) 499, 602, 682
BstC8I GCNNGC 4 cut(s) 12, 102, 112, 339
BstDEI CTNAG 4 cut(s) 428, 518, 586, 658
BstF5I GGATG 4 cut(s) 207, 361, 617, 680
BstFNI CGCG 1 cut(s) 464
BstHHI GCGC 1 cut(s) 157
BstMAI GTCTC 1 cut(s) 661
BstMWI GCNNNNNNNGC 2 cut(s) 287, 416
BstNI CCWGG 1 cut(s) 668
BstNSI RCATGY 2 cut(s) 427, 719
BstSCI CCNGG 1 cut(s) 666
BstSFI CTRYAG 1 cut(s) 417
BstUI CGCG 1 cut(s) 464
BstV1I GCAGC 5 cut(s) 76, 293, 403, 469, 569
BsuRI GGCC 2 cut(s) 141, 373
BtsCI GGATG 4 cut(s) 207, 361, 617, 680
BtsI GCAGTG 1 cut(s) 291
BtsIMutI CAGTG 3 cut(s) 291, 636, 678
Cac8I GCNNGC 4 cut(s) 12, 102, 112, 339
CaiI CAGNNNCTG 1 cut(s) 344
CfoI GCGC 1 cut(s) 157
Cfr13I GGNCC 1 cut(s) 233
CseI GACGC 2 cut(s) 251, 554
Csp6I GTAC 1 cut(s) 259
CviAII CATG 3 cut(s) 38, 424, 716
CviQI GTAC 1 cut(s) 259
DdeI CTNAG 4 cut(s) 428, 518, 586, 658
EaeI YGGCCR 1 cut(s) 371
Eco130I CCWWGG 1 cut(s) 217
Eco47I GGWCC 1 cut(s) 233
EcoRII CCWGG 1 cut(s) 666
EcoT14I CCWWGG 1 cut(s) 217
ErhI CCWWGG 1 cut(s) 217
FaeI CATG 3 cut(s) 41, 427, 719
FatI CATG 3 cut(s) 37, 423, 715
FblI GTMKAC 1 cut(s) 127
Fnu4HI GCNGC 5 cut(s) 90, 282, 417, 483, 583
FokI GGATG 4 cut(s) 214, 348, 624, 687
Fsp4HI GCNGC 5 cut(s) 90, 282, 417, 483, 583
FspBI CTAG 4 cut(s) 218, 278, 314, 354
GlaI GCGC 1 cut(s) 156
GluI GCNGC 5 cut(s) 90, 282, 417, 483, 583
GsuI CTGGAG 1 cut(s) 345
HaeIII GGCC 2 cut(s) 141, 373
HgaI GACGC 2 cut(s) 251, 554
HhaI GCGC 1 cut(s) 157
Hin1II CATG 3 cut(s) 41, 427, 719
Hin6I GCGC 1 cut(s) 155
HinP1I GCGC 1 cut(s) 155
HincII GTYRAC 1 cut(s) 502
HindII GTYRAC 1 cut(s) 502
HindIII AAGCTT 2 cut(s) 408, 515
HinfI GANTC 1 cut(s) 272
Hpy166II GTNNAC 5 cut(s) 128, 259, 311, 502, 569
Hpy188III TCNNGA 1 cut(s) 609
Hpy8I GTNNAC 5 cut(s) 128, 259, 311, 502, 569
HpyAV CCTTC 2 cut(s) 370, 468
HpyCH4III ACNGT 3 cut(s) 499, 602, 682
HpyCH4V TGCA 3 cut(s) 53, 419, 678
HpyF10VI GCNNNNNNNGC 2 cut(s) 287, 416
HpyF3I CTNAG 4 cut(s) 428, 518, 586, 658
Hsp92II CATG 3 cut(s) 41, 427, 719
HspAI GCGC 1 cut(s) 155
LmnI GCTCC 1 cut(s) 7
Lsp1109I GCAGC 5 cut(s) 76, 293, 403, 469, 569
LweI GCATC 4 cut(s) 40, 324, 370, 665
MaeI CTAG 4 cut(s) 218, 278, 314, 354
MaeIII GTNAC 1 cut(s) 493
MboII GAAGA 2 cut(s) 488, 551
MluCI AATT 4 cut(s) 391, 468, 526, 646
MnlI CCTC 5 cut(s) 10, 192, 299, 665, 703
MseI TTAA 1 cut(s) 684
MspR9I CCNGG 1 cut(s) 668
Mva1269I GAATGC 2 cut(s) 325, 441
MvaI CCWGG 1 cut(s) 668
MvnI CGCG 1 cut(s) 464
MwoI GCNNNNNNNGC 2 cut(s) 287, 416
NlaIII CATG 3 cut(s) 41, 427, 719
NmuCI GTSAC 1 cut(s) 493
NspI RCATGY 2 cut(s) 427, 719
PciI ACATGT 1 cut(s) 715
PctI GAATGC 2 cut(s) 325, 441
PfeI GAWTC 1 cut(s) 272
PkrI GCNGC 5 cut(s) 91, 283, 418, 484, 584
PscI ACATGT 1 cut(s) 715
Psp6I CCWGG 1 cut(s) 666
PspGI CCWGG 1 cut(s) 666
PspPI GGNCC 1 cut(s) 233
PstI CTGCAG 1 cut(s) 421
PstNI CAGNNNCTG 1 cut(s) 344
RsaI GTAC 1 cut(s) 260
RsaNI GTAC 1 cut(s) 259
SaqAI TTAA 1 cut(s) 684
SatI GCNGC 5 cut(s) 90, 282, 417, 483, 583
Sau96I GGNCC 1 cut(s) 233
ScrFI CCNGG 1 cut(s) 668
SfaNI GCATC 4 cut(s) 40, 324, 370, 665
SfcI CTRYAG 1 cut(s) 417
SinI GGWCC 1 cut(s) 233
SpeI ACTAGT 1 cut(s) 313
Sse9I AATT 4 cut(s) 391, 468, 526, 646
SsiI CCGC 2 cut(s) 78, 462
SspMI CTAG 4 cut(s) 218, 278, 314, 354
StyD4I CCNGG 1 cut(s) 666
StyI CCWWGG 1 cut(s) 217
TaaI ACNGT 3 cut(s) 499, 602, 682
TasI AATT 4 cut(s) 391, 468, 526, 646
TfiI GAWTC 1 cut(s) 272
Tru1I TTAA 1 cut(s) 684
Tru9I TTAA 1 cut(s) 684
TscAI CASTG 3 cut(s) 291, 643, 685
TseFI GTSAC 1 cut(s) 493
TseI GCWGC 5 cut(s) 89, 281, 416, 482, 582
Tsp45I GTSAC 1 cut(s) 493
TspDTI ATGAA 1 cut(s) 54
TspRI CASTG 3 cut(s) 291, 643, 685
VpaK11BI GGWCC 1 cut(s) 233
XapI RAATTY 2 cut(s) 468, 526
XceI RCATGY 2 cut(s) 427, 719
XmaJI CCTAGG 1 cut(s) 217
XmiI GTMKAC 1 cut(s) 127
XspI CTAG 4 cut(s) 218, 278, 314, 354
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.