Rmu_sc0002764.1_g000024

Tropinone reductase homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002764.1
OG0019369
Physical Location & Seq
Forward (+)
82731 .. 83839
1109 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002764.1_g000024.1.cds

Sequence Viewer

Length: 357 bp
atggcaaagagcagcggcaacctcacaagtccgagattaaccctcaggggaatgactgcccttgtcactggcgacactcttggaattgggtatgccatagtgggggagctagctgcgcttggtgcgtttgtgttcacctgttcttggaactcagtaaaactcgaaagcccacctcaagacgtcggaccacctccattagcagctgctagtggcacccttgagccgcaacactgccggaagcggcggcggtggacctggctccgttttgagccgatttcgagtcgatctcgatatctcgagctacaggccaccaattctcttgatttttggctcattggactcgcctcaacttcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
ko00960 ko01100 ko01110 map00960 map01100 map01110
Pfam Domains
Protein Families
adh_short adh_short_C2

Protein Analysis

118

Amino Acids

12.82

Weight (kDa)

9.58

Isoelectric Point (pI)

55.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019369)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0122161 RchiOBHm_Chr4g0423501 RchiOBHm_Chr7g0223341
rosa_multiflora Rmu_sc0000805.1_g000031 Rmu_sc0002764.1_g000024
rosa_roxburghii Rroxscaffold_3G00224030
rosa_samantha Rh2AG252300 Rh2DG260500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 183
AccB1I GGYRCC 1 cut(s) 212
AciI CCGC 5 cut(s) 15, 224, 241, 244, 247
AcyI GRCGYC 1 cut(s) 180
AfiI CCNNNNNNNGG 2 cut(s) 102, 144
AjnI CCWGG 1 cut(s) 254
AluBI AGCT 4 cut(s) 109, 113, 203, 301
AluI AGCT 4 cut(s) 109, 113, 203, 301
Ama87I CYCGRG 1 cut(s) 296
AoxI GGCC 1 cut(s) 306
ApeKI GCWGC 4 cut(s) 12, 113, 200, 203
AspLEI GCGC 1 cut(s) 118
AspS9I GGNCC 2 cut(s) 185, 252
AsuHPI GGTGA 1 cut(s) 127
AsuNHI GCTAGC 1 cut(s) 109
AvaI CYCGRG 1 cut(s) 296
AvaII GGWCC 2 cut(s) 185, 252
AxyI CCTNAGG 1 cut(s) 44
BanI GGYRCC 1 cut(s) 212
BbvI GCAGC 4 cut(s) 24, 100, 190, 212
BciT130I CCWGG 1 cut(s) 256
BfaI CTAG 2 cut(s) 110, 207
BfmI CTRYAG 1 cut(s) 302
BisI GCNGC 8 cut(s) 13, 16, 114, 201, 204, 224, 242, 245
BlsI GCNGC 8 cut(s) 14, 17, 115, 202, 205, 225, 243, 246
Bme1390I CCNGG 1 cut(s) 256
Bme18I GGWCC 2 cut(s) 185, 252
BmeT110I CYCGRG 1 cut(s) 296
BmgT120I GGNCC 2 cut(s) 185, 252
BmiI GGNNCC 2 cut(s) 214, 260
BmrFI CCNGG 1 cut(s) 256
BmtI GCTAGC 1 cut(s) 113
BplI GAGNNNNNCTC 2 cut(s) 271, 303
BpuEI CTTGAG 2 cut(s) 159, 239
BsaHI GRCGYC 1 cut(s) 180
Bsc4I CCNNNNNNNGG 2 cut(s) 102, 144
Bse1I ACTGG 1 cut(s) 73
Bse21I CCTNAGG 1 cut(s) 44
BseBI CCWGG 1 cut(s) 256
BseLI CCNNNNNNNGG 2 cut(s) 102, 144
BseMII CTCAG 2 cut(s) 58, 165
BseNI ACTGG 1 cut(s) 73
BseXI GCAGC 4 cut(s) 24, 100, 190, 212
BshFI GGCC 1 cut(s) 308
BshNI GGYRCC 1 cut(s) 212
BsiHKCI CYCGRG 1 cut(s) 296
BsiSI CCGG 1 cut(s) 235
BslI CCNNNNNNNGG 2 cut(s) 102, 144
BsnI GGCC 1 cut(s) 308
BsoBI CYCGRG 1 cut(s) 296
Bsp143I GATC 1 cut(s) 284
BspACI CCGC 5 cut(s) 15, 224, 241, 244, 247
BspANI GGCC 1 cut(s) 308
BspCNI CTCAG 2 cut(s) 57, 164
BspLI GGNNCC 2 cut(s) 214, 260
BspOI GCTAGC 1 cut(s) 113
BspT107I GGYRCC 1 cut(s) 212
BsrI ACTGG 1 cut(s) 73
BssMI GATC 1 cut(s) 284
BssNI GRCGYC 1 cut(s) 180
Bst2UI CCWGG 1 cut(s) 256
BstACI GRCGYC 1 cut(s) 180
BstC8I GCNNGC 1 cut(s) 111
BstDEI CTNAG 2 cut(s) 44, 151
BstHHI GCGC 1 cut(s) 118
BstKTI GATC 1 cut(s) 287
BstMBI GATC 1 cut(s) 284
BstMWI GCNNNNNNNGC 2 cut(s) 115, 122
BstNI CCWGG 1 cut(s) 256
BstSCI CCNGG 1 cut(s) 254
BstSFI CTRYAG 1 cut(s) 302
BstV1I GCAGC 4 cut(s) 24, 100, 190, 212
Bsu36I CCTNAGG 1 cut(s) 44
BsuRI GGCC 1 cut(s) 308
BtsI GCAGTG 1 cut(s) 229
BtsIMutI CAGTG 2 cut(s) 66, 229
Cac8I GCNNGC 1 cut(s) 111
CfoI GCGC 1 cut(s) 118
Cfr13I GGNCC 2 cut(s) 185, 252
DdeI CTNAG 2 cut(s) 44, 151
DpnI GATC 1 cut(s) 286
DpnII GATC 1 cut(s) 284
Eco32I GATATC 1 cut(s) 293
Eco47I GGWCC 2 cut(s) 185, 252
Eco81I CCTNAGG 1 cut(s) 44
Eco88I CYCGRG 1 cut(s) 296
EcoRII CCWGG 1 cut(s) 254
EcoRV GATATC 1 cut(s) 293
FaiI YATR 2 cut(s) 93, 98
Fnu4HI GCNGC 8 cut(s) 13, 16, 114, 201, 204, 224, 242, 245
Fsp4HI GCNGC 8 cut(s) 13, 16, 114, 201, 204, 224, 242, 245
FspBI CTAG 2 cut(s) 110, 207
GlaI GCGC 1 cut(s) 117
GluI GCNGC 8 cut(s) 13, 16, 114, 201, 204, 224, 242, 245
HaeIII GGCC 1 cut(s) 308
HapII CCGG 1 cut(s) 235
HhaI GCGC 1 cut(s) 118
Hin1I GRCGYC 1 cut(s) 180
Hin6I GCGC 1 cut(s) 116
HinP1I GCGC 1 cut(s) 116
HinfI GANTC 2 cut(s) 280, 339
HpaII CCGG 1 cut(s) 235
HphI GGTGA 1 cut(s) 127
Hpy166II GTNNAC 2 cut(s) 135, 252
Hpy188I TCNGA 2 cut(s) 33, 185
Hpy188III TCNNGA 5 cut(s) 176, 288, 296, 320, 354
Hpy8I GTNNAC 2 cut(s) 135, 252
Hpy99I CGWCG 1 cut(s) 185
HpyCH4IV ACGT 1 cut(s) 180
HpyF10VI GCNNNNNNNGC 2 cut(s) 115, 122
HpyF3I CTNAG 2 cut(s) 44, 151
HpySE526I ACGT 1 cut(s) 180
Hsp92I GRCGYC 1 cut(s) 180
HspAI GCGC 1 cut(s) 116
Kzo9I GATC 1 cut(s) 284
LmnI GCTCC 2 cut(s) 106, 264
LpnPI CCDG 7 cut(s) 31, 54, 151, 241, 248, 268, 290
Lsp1109I GCAGC 4 cut(s) 24, 100, 190, 212
MaeI CTAG 2 cut(s) 110, 207
MaeII ACGT 1 cut(s) 180
MaeIII GTNAC 1 cut(s) 64
MalI GATC 1 cut(s) 286
MboI GATC 1 cut(s) 284
MluCI AATT 2 cut(s) 84, 313
MlyI GAGTC 2 cut(s) 289, 333
MmeI TCCRAC 1 cut(s) 163
MnlI CCTC 5 cut(s) 32, 53, 183, 201, 355
MseI TTAA 1 cut(s) 38
MspA1I CMGCKG 2 cut(s) 15, 203
MspI CCGG 1 cut(s) 235
MspR9I CCNGG 1 cut(s) 256
MvaI CCWGG 1 cut(s) 256
MwoI GCNNNNNNNGC 2 cut(s) 115, 122
NdeII GATC 1 cut(s) 284
NheI GCTAGC 1 cut(s) 109
NlaIV GGNNCC 2 cut(s) 214, 260
NmuCI GTSAC 1 cut(s) 64
PaeR7I CTCGAG 1 cut(s) 296
PkrI GCNGC 8 cut(s) 14, 17, 115, 202, 205, 225, 243, 246
PleI GAGTC 2 cut(s) 288, 333
PpsI GAGTC 2 cut(s) 288, 333
Psp6I CCWGG 1 cut(s) 254
PspGI CCWGG 1 cut(s) 254
PspN4I GGNNCC 2 cut(s) 214, 260
PspPI GGNCC 2 cut(s) 185, 252
PvuII CAGCTG 1 cut(s) 203
SaqAI TTAA 1 cut(s) 38
SatI GCNGC 8 cut(s) 13, 16, 114, 201, 204, 224, 242, 245
Sau3AI GATC 1 cut(s) 284
Sau96I GGNCC 2 cut(s) 185, 252
SchI GAGTC 2 cut(s) 289, 333
ScrFI CCNGG 1 cut(s) 256
SfcI CTRYAG 1 cut(s) 302
Sfr274I CTCGAG 1 cut(s) 296
SinI GGWCC 2 cut(s) 185, 252
SlaI CTCGAG 1 cut(s) 296
SmlI CTYRAG 3 cut(s) 174, 218, 296
SmoI CTYRAG 3 cut(s) 174, 218, 296
Sse9I AATT 2 cut(s) 84, 313
SsiI CCGC 5 cut(s) 15, 224, 241, 244, 247
SspMI CTAG 2 cut(s) 110, 207
StyD4I CCNGG 1 cut(s) 254
TaiI ACGT 1 cut(s) 183
TaqI TCGA 5 cut(s) 162, 278, 283, 289, 297
TasI AATT 2 cut(s) 84, 313
TauI GCSGC 4 cut(s) 18, 226, 244, 247
Tru1I TTAA 1 cut(s) 38
Tru9I TTAA 1 cut(s) 38
TscAI CASTG 2 cut(s) 73, 236
TseFI GTSAC 1 cut(s) 64
TseI GCWGC 4 cut(s) 12, 113, 200, 203
Tsp45I GTSAC 1 cut(s) 64
TspGWI ACGGA 1 cut(s) 251
TspRI CASTG 2 cut(s) 73, 236
VpaK11BI GGWCC 2 cut(s) 185, 252
XhoI CTCGAG 1 cut(s) 296
XspI CTAG 2 cut(s) 110, 207
ZraI GACGTC 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.