Rmu_sc0002829.1_g000012

BTB POZ domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002829.1
Physical Location & Seq
Forward (+)
38751 .. 39493
743 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002829.1_g000012.1.cds

Sequence Viewer

Length: 564 bp
atgaggcctcgatcaaatccaccgtcgaagcctctctcttcgcctccgcctctgcctcttgatcggcaattcagtatgcagatggatgagtcagaggacttggaatcggaatcagaattggaatggaaaagggaagaaagagagagagtggatgatggtgtggtgagatttgctgagttgattcggtgtggaaatgtagtttgggatatacaagagaaagttgattgcttttcggatttcatggtttcggaaaacttgttagtaatgttcaagattggtgtgaatttcagtgcagtgttcattgcagatttgagaaatttaggtgtggagtgggcttgggtttgtcttggtaataggaagaaaatggttattgaaaaaaaggagggattgaaagccatggaagccgagtgttttgtagttgggaggggggcagagagagatttagaggtgtgctcagaggtatttataggctctaagaagagtagtgaaggtgggtcaaatgacatgctccttaggaagtatgtaatggggacgatggggagtatagggaagattccaggataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

187

Amino Acids

21.13

Weight (kDa)

4.98

Isoelectric Point (pI)

34.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017937)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G46390
malus_domestica MD01G1077100.v1.1 MD07G1146600.v1.1
prunus_persica Prupe.2G184600_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0359021
rosa_laevigata RLG00000027908
rosa_multiflora Rmu_sc0002829.1_g000012
rosa_roxburghii Rroxscaffold_4G00297450
rosa_samantha Rh1AG280500 Rh7DG250000
rosa_wichuraiana Rw1G024940

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 47
AcsI RAATTY 2 cut(s) 283, 316
AgsI TTSAA 3 cut(s) 271, 374, 391
AjnI CCWGG 1 cut(s) 556
AjuI GAANNNNNNNTTGG 2 cut(s) 184, 216
Alw21I GWGCWC 1 cut(s) 455
AoxI GGCC 1 cut(s) 5
ApoI RAATTY 2 cut(s) 283, 316
ArsI GACNNNNNNTTYG 2 cut(s) 8, 40
AsuHPI GGTGA 1 cut(s) 175
AxyI CCTNAGG 1 cut(s) 512
Bbv12I GWGCWC 1 cut(s) 455
BccI CCATC 3 cut(s) 76, 149, 529
BciT130I CCWGG 1 cut(s) 558
Bme1390I CCNGG 1 cut(s) 558
BmrFI CCNGG 1 cut(s) 558
BplI GAGNNNNNCTC 2 cut(s) 437, 469
BsaJI CCNNGG 1 cut(s) 396
Bse21I CCTNAGG 1 cut(s) 512
Bse3DI GCAATG 1 cut(s) 300
BseBI CCWGG 1 cut(s) 558
BseDI CCNNGG 1 cut(s) 396
BseGI GGATG 2 cut(s) 91, 157
BseMI GCAATG 1 cut(s) 300
BseMII CTCAG 2 cut(s) 165, 468
BsgI GTGCAG 1 cut(s) 312
BshFI GGCC 1 cut(s) 7
BsiHKAI GWGCWC 1 cut(s) 455
BslFI GGGAC 1 cut(s) 544
BsmFI GGGAC 1 cut(s) 544
BsnI GGCC 1 cut(s) 7
Bsp1286I GDGCHC 1 cut(s) 455
Bsp143I GATC 2 cut(s) 11, 61
Bsp19I CCATGG 1 cut(s) 396
BspACI CCGC 1 cut(s) 47
BspANI GGCC 1 cut(s) 7
BspCNI CTCAG 2 cut(s) 166, 467
BsrDI GCAATG 1 cut(s) 300
BssECI CCNNGG 1 cut(s) 396
BssMI GATC 2 cut(s) 11, 61
BssT1I CCWWGG 1 cut(s) 396
Bst2UI CCWGG 1 cut(s) 558
Bst4CI ACNGT 1 cut(s) 24
Bst6I CTCTTC 2 cut(s) 43, 473
BstDEI CTNAG 4 cut(s) 174, 454, 474, 512
BstDSI CCRYGG 1 cut(s) 396
BstF5I GGATG 2 cut(s) 91, 157
BstKTI GATC 2 cut(s) 14, 64
BstMBI GATC 2 cut(s) 11, 61
BstMWI GCNNNNNNNGC 1 cut(s) 401
BstNI CCWGG 1 cut(s) 558
BstNSI RCATGY 1 cut(s) 508
BstSCI CCNGG 1 cut(s) 556
Bsu36I CCTNAGG 1 cut(s) 512
BsuRI GGCC 1 cut(s) 7
BtgI CCRYGG 1 cut(s) 396
BtsCI GGATG 2 cut(s) 91, 157
BtsI GCAGTG 1 cut(s) 300
BtsIMutI CAGTG 2 cut(s) 295, 300
CviAII CATG 3 cut(s) 241, 397, 505
CviJI RGCY 6 cut(s) 7, 31, 335, 395, 404, 471
CviKI_1 RGCY 6 cut(s) 7, 31, 335, 395, 404, 471
DdeI CTNAG 4 cut(s) 174, 454, 474, 512
DpnI GATC 2 cut(s) 13, 63
DpnII GATC 2 cut(s) 11, 61
Eam1104I CTCTTC 2 cut(s) 43, 473
EarI CTCTTC 2 cut(s) 43, 473
EciI GGCGGA 1 cut(s) 36
Eco130I CCWWGG 1 cut(s) 396
Eco147I AGGCCT 1 cut(s) 7
Eco81I CCTNAGG 1 cut(s) 512
EcoRII CCWGG 1 cut(s) 556
EcoT14I CCWWGG 1 cut(s) 396
ErhI CCWWGG 1 cut(s) 396
FaeI CATG 3 cut(s) 244, 400, 508
FaiI YATR 8 cut(s) 77, 209, 242, 398, 467, 506, 522, 545
FaqI GGGAC 1 cut(s) 544
FatI CATG 3 cut(s) 240, 396, 504
FokI GGATG 2 cut(s) 98, 164
HaeIII GGCC 1 cut(s) 7
Hin1II CATG 3 cut(s) 244, 400, 508
HinfI GANTC 5 cut(s) 89, 104, 110, 181, 553
HphI GGTGA 1 cut(s) 175
Hpy188I TCNGA 6 cut(s) 94, 109, 115, 235, 250, 457
Hpy188III TCNNGA 2 cut(s) 59, 271
Hpy99I CGWCG 1 cut(s) 28
HpyAV CCTTC 1 cut(s) 482
HpyCH4III ACNGT 1 cut(s) 24
HpyCH4V TGCA 3 cut(s) 79, 293, 305
HpyF10VI GCNNNNNNNGC 1 cut(s) 401
HpyF3I CTNAG 4 cut(s) 174, 454, 474, 512
Hsp92II CATG 3 cut(s) 244, 400, 508
Kzo9I GATC 2 cut(s) 11, 61
LmnI GCTCC 1 cut(s) 513
LpnPI CCDG 1 cut(s) 543
MalI GATC 2 cut(s) 13, 63
MboI GATC 2 cut(s) 11, 61
MboII GAAGA 5 cut(s) 30, 146, 370, 490, 562
MhlI GDGCHC 1 cut(s) 455
MluCI AATT 4 cut(s) 68, 116, 283, 316
MlyI GAGTC 1 cut(s) 98
MspR9I CCNGG 1 cut(s) 558
MvaI CCWGG 1 cut(s) 558
MwoI GCNNNNNNNGC 1 cut(s) 401
NcoI CCATGG 1 cut(s) 396
NdeII GATC 2 cut(s) 11, 61
NlaIII CATG 3 cut(s) 244, 400, 508
NmeAIII GCCGAG 1 cut(s) 430
NspI RCATGY 1 cut(s) 508
PceI AGGCCT 1 cut(s) 7
PfeI GAWTC 4 cut(s) 104, 110, 181, 553
PfoI TCCNGGA 1 cut(s) 556
PleI GAGTC 1 cut(s) 97
PpsI GAGTC 1 cut(s) 97
Psp6I CCWGG 1 cut(s) 556
PspGI CCWGG 1 cut(s) 556
Sau3AI GATC 2 cut(s) 11, 61
SchI GAGTC 1 cut(s) 98
ScrFI CCNGG 1 cut(s) 558
SduI GDGCHC 1 cut(s) 455
SetI ASST 4 cut(s) 325, 450, 462, 493
Sse9I AATT 4 cut(s) 68, 116, 283, 316
SseBI AGGCCT 1 cut(s) 7
SsiI CCGC 1 cut(s) 47
StuI AGGCCT 1 cut(s) 7
StyD4I CCNGG 1 cut(s) 556
StyI CCWWGG 1 cut(s) 396
TaaI ACNGT 1 cut(s) 24
TaqI TCGA 2 cut(s) 10, 26
TasI AATT 4 cut(s) 68, 116, 283, 316
TfiI GAWTC 4 cut(s) 104, 110, 181, 553
TscAI CASTG 2 cut(s) 295, 300
TspDTI ATGAA 2 cut(s) 229, 289
TspRI CASTG 2 cut(s) 295, 300
XapI RAATTY 2 cut(s) 283, 316
XceI RCATGY 1 cut(s) 508
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.