Rmu_sc0003282.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003282.1
OG0016614
Physical Location & Seq
Reverse (-)
1627 .. 2037
411 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003282.1_g000001.1.cds

Sequence Viewer

Length: 411 bp
atggagtcgaatcgcaagcgcagagggttcatgaaggggaagttgacgccattctatcgtgtttccaaaccttcctcaacctcaactactacaactactagtacaactagcaagcagtctagcatgcaatacatgatgagcagcaaggttcagccgagccaggcctatcctttaccatcttcggtagggtttctggtccacaaccacaaggactatcatgtcattgcaactcaggttcaggctcaacctaaacagaagattaccttcatagtaccaccttctcctgcagatcgcaagcagcagcagcagcagctcgatcataaccttgctggtgatgagatggttgatatgaaggcggcaacctatatttcatcagttcaagaacgtttcaagcttgaacgtaacaattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

136

Amino Acids

15.44

Weight (kDa)

10.04

Isoelectric Point (pI)

65.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016614)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G01960
fragaria_vesca FvH4_6g53750
prunus_persica Prupe.3G308000_v2.0.a1
pyrus_communis pycom17g00770
rosa_chinensis RchiOBHm_Chr2g0175871
rosa_laevigata RLG00000022361
rosa_multiflora Rmu_sc0003282.1_g000001
rosa_roxburghii Rroxscaffold_2G00076980
rosa_rugosa Rorug02G0588200
rosa_samantha Rh2AG667500 Rh2BG679000 Rh2CG641800 Rh2DG692500
rosa_wichuraiana Rw2G054710

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 218
AciI CCGC 1 cut(s) 356
AclI AACGTT 1 cut(s) 385
AcyI GRCGYC 1 cut(s) 47
AfaI GTAC 2 cut(s) 103, 273
AgsI TTSAA 3 cut(s) 380, 391, 398
AhlI ACTAGT 1 cut(s) 98
AjnI CCWGG 1 cut(s) 159
AluBI AGCT 2 cut(s) 313, 394
AluI AGCT 2 cut(s) 313, 394
AoxI GGCC 1 cut(s) 162
ApeKI GCWGC 6 cut(s) 141, 298, 301, 304, 307, 310
AspLEI GCGC 1 cut(s) 21
AspS9I GGNCC 1 cut(s) 196
AsuHPI GGTGA 1 cut(s) 344
AvaII GGWCC 1 cut(s) 196
BbvI GCAGC 6 cut(s) 153, 310, 313, 316, 319, 322
BccI CCATC 2 cut(s) 184, 334
BciT130I CCWGG 1 cut(s) 161
BcuI ACTAGT 1 cut(s) 98
BfaI CTAG 3 cut(s) 99, 108, 120
BfmI CTRYAG 1 cut(s) 285
BisI GCNGC 7 cut(s) 142, 299, 302, 305, 308, 311, 357
BlsI GCNGC 7 cut(s) 143, 300, 303, 306, 309, 312, 358
Bme1390I CCNGG 1 cut(s) 161
Bme18I GGWCC 1 cut(s) 196
BmgT120I GGNCC 1 cut(s) 196
BmrFI CCNGG 1 cut(s) 161
BsaHI GRCGYC 1 cut(s) 47
Bse3DI GCAATG 1 cut(s) 222
BseBI CCWGG 1 cut(s) 161
BseMI GCAATG 1 cut(s) 222
BseMII CTCAG 1 cut(s) 245
BseXI GCAGC 6 cut(s) 153, 310, 313, 316, 319, 322
BshFI GGCC 1 cut(s) 164
BsnI GGCC 1 cut(s) 164
Bsp143I GATC 2 cut(s) 289, 316
BspACI CCGC 1 cut(s) 356
BspANI GGCC 1 cut(s) 164
BspCNI CTCAG 1 cut(s) 244
BspHI TCATGA 1 cut(s) 30
BspMAI CTGCAG 1 cut(s) 289
BsrDI GCAATG 1 cut(s) 222
BssMI GATC 2 cut(s) 289, 316
BssNI GRCGYC 1 cut(s) 47
Bst2UI CCWGG 1 cut(s) 161
BstACI GRCGYC 1 cut(s) 47
BstC8I GCNNGC 4 cut(s) 17, 113, 125, 296
BstDEI CTNAG 1 cut(s) 231
BstHHI GCGC 1 cut(s) 21
BstKTI GATC 2 cut(s) 292, 319
BstMBI GATC 2 cut(s) 289, 316
BstMWI GCNNNNNNNGC 3 cut(s) 304, 307, 310
BstNI CCWGG 1 cut(s) 161
BstNSI RCATGY 1 cut(s) 127
BstSCI CCNGG 1 cut(s) 159
BstSFI CTRYAG 1 cut(s) 285
BstV1I GCAGC 6 cut(s) 153, 310, 313, 316, 319, 322
BsuRI GGCC 1 cut(s) 164
Cac8I GCNNGC 4 cut(s) 17, 113, 125, 296
CciI TCATGA 1 cut(s) 30
CfoI GCGC 1 cut(s) 21
Cfr13I GGNCC 1 cut(s) 196
CseI GACGC 1 cut(s) 55
Csp6I GTAC 2 cut(s) 102, 272
CviAII CATG 4 cut(s) 31, 124, 133, 218
CviJI RGCY 6 cut(s) 154, 159, 164, 242, 313, 394
CviKI_1 RGCY 6 cut(s) 154, 159, 164, 242, 313, 394
CviQI GTAC 2 cut(s) 102, 272
DdeI CTNAG 1 cut(s) 231
DpnI GATC 2 cut(s) 291, 318
DpnII GATC 2 cut(s) 289, 316
DrdI GACNNNNNNGTC 1 cut(s) 218
DseDI GACNNNNNNGTC 1 cut(s) 218
Eco147I AGGCCT 1 cut(s) 164
Eco47I GGWCC 1 cut(s) 196
EcoRII CCWGG 1 cut(s) 159
FaeI CATG 4 cut(s) 34, 127, 136, 221
FaiI YATR 8 cut(s) 32, 125, 134, 219, 269, 321, 350, 366
FalI AAGNNNNNCTT 2 cut(s) 248, 280
FatI CATG 4 cut(s) 30, 123, 132, 217
Fnu4HI GCNGC 7 cut(s) 142, 299, 302, 305, 308, 311, 357
Fsp4HI GCNGC 7 cut(s) 142, 299, 302, 305, 308, 311, 357
FspBI CTAG 3 cut(s) 99, 108, 120
GlaI GCGC 1 cut(s) 20
GluI GCNGC 7 cut(s) 142, 299, 302, 305, 308, 311, 357
HaeIII GGCC 1 cut(s) 164
HgaI GACGC 1 cut(s) 55
HhaI GCGC 1 cut(s) 21
Hin1I GRCGYC 1 cut(s) 47
Hin1II CATG 4 cut(s) 34, 127, 136, 221
Hin6I GCGC 1 cut(s) 19
HinP1I GCGC 1 cut(s) 19
HincII GTYRAC 1 cut(s) 45
HindII GTYRAC 1 cut(s) 45
HindIII AAGCTT 1 cut(s) 392
HinfI GANTC 2 cut(s) 5, 10
HphI GGTGA 1 cut(s) 344
Hpy166II GTNNAC 2 cut(s) 45, 199
Hpy188III TCNNGA 2 cut(s) 31, 380
Hpy8I GTNNAC 2 cut(s) 45, 199
HpyAV CCTTC 5 cut(s) 28, 81, 274, 288, 346
HpyCH4IV ACGT 2 cut(s) 385, 400
HpyCH4V TGCA 3 cut(s) 127, 227, 287
HpyF10VI GCNNNNNNNGC 3 cut(s) 304, 307, 310
HpyF3I CTNAG 1 cut(s) 231
HpySE526I ACGT 2 cut(s) 385, 400
Hsp92I GRCGYC 1 cut(s) 47
Hsp92II CATG 4 cut(s) 34, 127, 136, 221
HspAI GCGC 1 cut(s) 19
Kzo9I GATC 2 cut(s) 289, 316
LpnPI CCDG 7 cut(s) 146, 173, 179, 218, 224, 297, 315
Lsp1109I GCAGC 6 cut(s) 153, 310, 313, 316, 319, 322
MaeI CTAG 3 cut(s) 99, 108, 120
MaeII ACGT 2 cut(s) 385, 400
MaeIII GTNAC 1 cut(s) 401
MalI GATC 2 cut(s) 291, 318
MboI GATC 2 cut(s) 289, 316
MboII GAAGA 2 cut(s) 171, 268
MluCI AATT 1 cut(s) 406
MlyI GAGTC 1 cut(s) 14
MnlI CCTC 3 cut(s) 17, 85, 91
MseI TTAA 1 cut(s) 409
MspR9I CCNGG 1 cut(s) 161
MvaI CCWGG 1 cut(s) 161
MwoI GCNNNNNNNGC 3 cut(s) 304, 307, 310
NdeII GATC 2 cut(s) 289, 316
NlaIII CATG 4 cut(s) 34, 127, 136, 221
NmeAIII GCCGAG 1 cut(s) 180
NspI RCATGY 1 cut(s) 127
PaeI GCATGC 1 cut(s) 127
PagI TCATGA 1 cut(s) 30
PceI AGGCCT 1 cut(s) 164
PfeI GAWTC 1 cut(s) 10
PkrI GCNGC 7 cut(s) 143, 300, 303, 306, 309, 312, 358
PleI GAGTC 1 cut(s) 13
PpsI GAGTC 1 cut(s) 13
Psp1406I AACGTT 1 cut(s) 385
Psp6I CCWGG 1 cut(s) 159
PspGI CCWGG 1 cut(s) 159
PspPI GGNCC 1 cut(s) 196
PstI CTGCAG 1 cut(s) 289
RsaI GTAC 2 cut(s) 103, 273
RsaNI GTAC 2 cut(s) 102, 272
SaqAI TTAA 1 cut(s) 409
SatI GCNGC 7 cut(s) 142, 299, 302, 305, 308, 311, 357
Sau3AI GATC 2 cut(s) 289, 316
Sau96I GGNCC 1 cut(s) 196
SchI GAGTC 1 cut(s) 14
ScrFI CCNGG 1 cut(s) 161
SfcI CTRYAG 1 cut(s) 285
SinI GGWCC 1 cut(s) 196
SpeI ACTAGT 1 cut(s) 98
SphI GCATGC 1 cut(s) 127
Sse9I AATT 1 cut(s) 406
SseBI AGGCCT 1 cut(s) 164
SsiI CCGC 1 cut(s) 356
SspMI CTAG 3 cut(s) 99, 108, 120
StuI AGGCCT 1 cut(s) 164
StyD4I CCNGG 1 cut(s) 159
TaiI ACGT 2 cut(s) 388, 403
TaqI TCGA 2 cut(s) 8, 315
TasI AATT 1 cut(s) 406
TatI WGTACW 1 cut(s) 101
TauI GCSGC 1 cut(s) 359
TfiI GAWTC 1 cut(s) 10
Tru1I TTAA 1 cut(s) 409
Tru9I TTAA 1 cut(s) 409
TseI GCWGC 6 cut(s) 141, 298, 301, 304, 307, 310
TspDTI ATGAA 5 cut(s) 19, 47, 256, 360, 365
VpaK11BI GGWCC 1 cut(s) 196
XceI RCATGY 1 cut(s) 127
XspI CTAG 3 cut(s) 99, 108, 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.