Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003311.1

Orthogroup ID

OG0019819

Physical Location & Seq

Genomic Coordinates Reverse (-)

12977 .. 13392

Gene Structure 416 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003311.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 291 bp

ctgcccccaaaccagcgagtcaagtggcgcagtgactcaggacttaaggatggcctagctcaaggggtggacctggttggagggtattatgatgcaggggatcatgtgaaatttgggctaccaatggcattcacagtgacaatgctttcatggggagctattgagttcaggaaggagatcacagatttagaccaattaggtcagacattatgggccattagatggggcactgactatttcatcaaagcacatccacagcctaatgttctttggggacaggtatacatctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00500 ko01100 map00500 map01100

Pfam Domains

Protein Families

CBM49 Glyco_hydro_9

Protein Analysis

96

Amino Acids

10.87

Weight (kDa)

6.06

Isoelectric Point (pI)

32.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019819)

Species	Orthologous Gene IDs
pyrus_communis	pycom06g10010 pycom17g12680
rosa_chinensis	RchiOBHm_Chr0c20g0500181 RchiOBHm_Chr1g0340171
rosa_multiflora	Rmu_sc0003311.1_g000003 Rmu_sc0032132.1_g000001
rosa_samantha	Rh1CG166700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	222
AccI	GTMKAC	1 cut(s)	282
AclWI	GGATC	1 cut(s)	108
AcsI	RAATTY	1 cut(s)	110
AfiI	CCNNNNNNNGG	1 cut(s)	222
AflII	CTTAAG	1 cut(s)	44
AjnI	CCWGG	1 cut(s)	72
AluBI	AGCT	2 cut(s)	59, 158
AluI	AGCT	2 cut(s)	59, 158
AlwI	GGATC	1 cut(s)	108
AoxI	GGCC	2 cut(s)	52, 213
ApoI	RAATTY	1 cut(s)	110
AspLEI	GCGC	1 cut(s)	30
AspS9I	GGNCC	2 cut(s)	70, 213
AvaII	GGWCC	1 cut(s)	70
BaeGI	GKGCMC	1 cut(s)	230
BccI	CCATC	2 cut(s)	44, 216
BciT130I	CCWGG	1 cut(s)	74
BfaI	CTAG	1 cut(s)	56
BfrI	CTTAAG	1 cut(s)	44
Bme1390I	CCNGG	1 cut(s)	74
Bme18I	GGWCC	1 cut(s)	70
BmgT120I	GGNCC	2 cut(s)	70, 213
BmrFI	CCNGG	1 cut(s)	74
BmsI	GCATC	1 cut(s)	82
BpuEI	CTTGAG	1 cut(s)	45
Bsc4I	CCNNNNNNNGG	1 cut(s)	222
BseBI	CCWGG	1 cut(s)	74
BseGI	GGATG	2 cut(s)	55, 250
BseLI	CCNNNNNNNGG	1 cut(s)	222
BseMII	CTCAG	1 cut(s)	51
BseSI	GKGCMC	1 cut(s)	230
BshFI	GGCC	2 cut(s)	54, 215
BslI	CCNNNNNNNGG	1 cut(s)	222
BsmI	GAATGC	1 cut(s)	128
BsnI	GGCC	2 cut(s)	54, 215
Bsp1286I	GDGCHC	1 cut(s)	230
Bsp143I	GATC	2 cut(s)	100, 177
BspANI	GGCC	2 cut(s)	54, 215
BspCNI	CTCAG	1 cut(s)	50
BspPI	GGATC	1 cut(s)	108
BspTI	CTTAAG	1 cut(s)	44
BssMI	GATC	2 cut(s)	100, 177
BssNAI	GTATAC	1 cut(s)	283
Bst1107I	GTATAC	1 cut(s)	283
Bst2UI	CCWGG	1 cut(s)	74
Bst4CI	ACNGT	1 cut(s)	136
BstAFI	CTTAAG	1 cut(s)	44
BstDEI	CTNAG	1 cut(s)	37
BstF5I	GGATG	2 cut(s)	55, 250
BstHHI	GCGC	1 cut(s)	30
BstKTI	GATC	2 cut(s)	103, 180
BstMBI	GATC	2 cut(s)	100, 177
BstNI	CCWGG	1 cut(s)	74
BstSCI	CCNGG	1 cut(s)	72
BstSLI	GKGCMC	1 cut(s)	230
BstZ17I	GTATAC	1 cut(s)	283
BsuRI	GGCC	2 cut(s)	54, 215
BtsCI	GGATG	2 cut(s)	55, 250
BtsI	GCAGTG	1 cut(s)	37
BtsIMutI	CAGTG	3 cut(s)	37, 141, 228
CfoI	GCGC	1 cut(s)	30
Cfr13I	GGNCC	2 cut(s)	70, 213
CsiI	ACCWGGT	1 cut(s)	72
CviAII	CATG	2 cut(s)	104, 150
CviJI	RGCY	6 cut(s)	54, 59, 118, 158, 215, 259
CviKI_1	RGCY	6 cut(s)	54, 59, 118, 158, 215, 259
DdeI	CTNAG	1 cut(s)	37
DpnI	GATC	2 cut(s)	102, 179
DpnII	GATC	2 cut(s)	100, 177
Eco47I	GGWCC	1 cut(s)	70
EcoRII	CCWGG	1 cut(s)	72
FaeI	CATG	2 cut(s)	107, 153
FaiI	YATR	5 cut(s)	90, 105, 151, 211, 283
FatI	CATG	2 cut(s)	103, 149
FblI	GTMKAC	1 cut(s)	282
FokI	GGATG	2 cut(s)	62, 237
FspBI	CTAG	1 cut(s)	56
GlaI	GCGC	1 cut(s)	29
HaeIII	GGCC	2 cut(s)	54, 215
HhaI	GCGC	1 cut(s)	30
Hin1II	CATG	2 cut(s)	107, 153
Hin6I	GCGC	1 cut(s)	28
HinP1I	GCGC	1 cut(s)	28
HinfI	GANTC	2 cut(s)	18, 35
Hpy166II	GTNNAC	2 cut(s)	70, 283
Hpy188I	TCNGA	1 cut(s)	204
Hpy188III	TCNNGA	2 cut(s)	39, 169
Hpy8I	GTNNAC	2 cut(s)	70, 283
HpyAV	CCTTC	1 cut(s)	166
HpyCH4III	ACNGT	1 cut(s)	136
HpyCH4V	TGCA	1 cut(s)	95
HpyF3I	CTNAG	1 cut(s)	37
Hsp92II	CATG	2 cut(s)	107, 153
HspAI	GCGC	1 cut(s)	28
Kzo9I	GATC	2 cut(s)	100, 177
LmnI	GCTCC	1 cut(s)	155
LpnPI	CCDG	7 cut(s)	24, 26, 59, 81, 86, 154, 263
LweI	GCATC	1 cut(s)	82
MabI	ACCWGGT	1 cut(s)	72
MaeI	CTAG	1 cut(s)	56
MaeIII	GTNAC	2 cut(s)	32, 136
MalI	GATC	2 cut(s)	102, 179
MboI	GATC	2 cut(s)	100, 177
MhlI	GDGCHC	1 cut(s)	230
MluCI	AATT	2 cut(s)	110, 194
MlyI	GAGTC	2 cut(s)	27, 29
MmeI	TCCRAC	1 cut(s)	58
MnlI	CCTC	1 cut(s)	74
MseI	TTAA	1 cut(s)	45
MspCI	CTTAAG	1 cut(s)	44
MspR9I	CCNGG	1 cut(s)	74
Mva1269I	GAATGC	1 cut(s)	128
MvaI	CCWGG	1 cut(s)	74
NdeII	GATC	2 cut(s)	100, 177
NlaIII	CATG	2 cut(s)	107, 153
NmuCI	GTSAC	2 cut(s)	32, 136
PctI	GAATGC	1 cut(s)	128
PflMI	CCANNNNNTGG	1 cut(s)	222
PleI	GAGTC	2 cut(s)	26, 29
PpsI	GAGTC	2 cut(s)	26, 29
Psp6I	CCWGG	1 cut(s)	72
PspGI	CCWGG	1 cut(s)	72
PspPI	GGNCC	2 cut(s)	70, 213
SaqAI	TTAA	1 cut(s)	45
Sau3AI	GATC	2 cut(s)	100, 177
Sau96I	GGNCC	2 cut(s)	70, 213
SchI	GAGTC	2 cut(s)	27, 29
ScrFI	CCNGG	1 cut(s)	74
SduI	GDGCHC	1 cut(s)	230
SetI	ASST	5 cut(s)	61, 75, 160, 202, 282
SexAI	ACCWGGT	1 cut(s)	72
SfaNI	GCATC	1 cut(s)	82
SinI	GGWCC	1 cut(s)	70
SmlI	CTYRAG	2 cut(s)	44, 60
SmoI	CTYRAG	2 cut(s)	44, 60
Sse9I	AATT	2 cut(s)	110, 194
SspMI	CTAG	1 cut(s)	56
StyD4I	CCNGG	1 cut(s)	72
TaaI	ACNGT	1 cut(s)	136
TasI	AATT	2 cut(s)	110, 194
Tru1I	TTAA	1 cut(s)	45
Tru9I	TTAA	1 cut(s)	45
TscAI	CASTG	3 cut(s)	37, 141, 235
TseFI	GTSAC	2 cut(s)	32, 136
Tsp45I	GTSAC	2 cut(s)	32, 136
TspDTI	ATGAA	2 cut(s)	138, 229
TspRI	CASTG	3 cut(s)	37, 141, 235
Van91I	CCANNNNNTGG	1 cut(s)	222
Vha464I	CTTAAG	1 cut(s)	44
VpaK11BI	GGWCC	1 cut(s)	70
XapI	RAATTY	1 cut(s)	110
XmiI	GTMKAC	1 cut(s)	282
XspI	CTAG	1 cut(s)	56

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.