Rmu_sc0003381.1_g000005

Protein of unknown function (DUF4050)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003381.1
Physical Location & Seq
Reverse (-)
11567 .. 13301
1735 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003381.1_g000005.1.cds

Sequence Viewer

Length: 318 bp
atggaaactaatggtagcatttctaattcccatgaaagtcaaccttcagatgcttcagatagtactaataaagagaagcctactgagaaagtagtctttatcaaccatgccgagatagcttggcaggagacaagaaaagaatgggttggtgatcagtctcaaaaaccacgaagagcaccaagagaaccaataatgagctggaccacaacgtatgaggatcttcttttaaccactcaacctttccaggagcccatacctttagctgaaatggtggattttttagttgatatatggctcgaagaaggcctatatgactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

12.14

Weight (kDa)

4.45

Isoelectric Point (pI)

44.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012852)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G03440 AT5G03440 AT5G03440
fragaria_vesca FvH4_6g16540
malus_domestica MD04G1091600.v1.1 MD12G1109500.v1.1
prunus_persica Prupe.7G128200_v2.0.a1
pyrus_communis pycom04g08630
rosa_chinensis RchiOBHm_Chr3g0470451
rosa_laevigata RLG00000024266
rosa_multiflora Rmu_sc0003381.1_g000005
rosa_roxburghii Rroxscaffold_6G00410790
rosa_rugosa Rorug03G0109200
rosa_samantha Rh3AG159600 Rh3BG184100 Rh3CG174600 Rh3DG190800
rosa_wichuraiana Rw3G015100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 225
AcuI CTGAAG 2 cut(s) 30, 39
AfaI GTAC 1 cut(s) 64
AjnI CCWGG 1 cut(s) 243
AluBI AGCT 3 cut(s) 119, 198, 263
AluI AGCT 3 cut(s) 119, 198, 263
Alw21I GWGCWC 1 cut(s) 178
Alw26I GTCTC 2 cut(s) 122, 162
AlwI GGATC 1 cut(s) 225
AoxI GGCC 1 cut(s) 304
AspS9I GGNCC 1 cut(s) 201
AsuHPI GGTGA 1 cut(s) 161
AvaII GGWCC 1 cut(s) 201
BanII GRGCYC 1 cut(s) 252
Bbv12I GWGCWC 1 cut(s) 178
BciT130I CCWGG 1 cut(s) 245
BclI TGATCA 1 cut(s) 151
BcoDI GTCTC 2 cut(s) 122, 162
BfaI CTAG 1 cut(s) 316
BmcAI AGTACT 1 cut(s) 64
Bme1390I CCNGG 1 cut(s) 245
Bme18I GGWCC 1 cut(s) 201
BmgT120I GGNCC 1 cut(s) 201
BmiI GGNNCC 1 cut(s) 249
BmrFI CCNGG 1 cut(s) 245
BmsI GCATC 1 cut(s) 40
BseBI CCWGG 1 cut(s) 245
BseMII CTCAG 1 cut(s) 75
BshFI GGCC 1 cut(s) 306
BsiHKAI GWGCWC 1 cut(s) 178
BsmAI GTCTC 2 cut(s) 122, 162
BsnI GGCC 1 cut(s) 306
Bsp1286I GDGCHC 2 cut(s) 178, 252
Bsp143I GATC 2 cut(s) 151, 217
BspANI GGCC 1 cut(s) 306
BspCNI CTCAG 1 cut(s) 76
BspLI GGNNCC 1 cut(s) 249
BspPI GGATC 1 cut(s) 225
BspQI GCTCTTC 1 cut(s) 166
BssMI GATC 2 cut(s) 151, 217
Bst2UI CCWGG 1 cut(s) 245
Bst6I CTCTTC 1 cut(s) 166
BstDEI CTNAG 1 cut(s) 84
BstKTI GATC 2 cut(s) 154, 220
BstMAI GTCTC 2 cut(s) 122, 162
BstMBI GATC 2 cut(s) 151, 217
BstMWI GCNNNNNNNGC 1 cut(s) 116
BstNI CCWGG 1 cut(s) 245
BstSCI CCNGG 1 cut(s) 243
BstX2I RGATCY 1 cut(s) 217
BstYI RGATCY 1 cut(s) 217
BsuRI GGCC 1 cut(s) 306
Cfr13I GGNCC 1 cut(s) 201
Csp6I GTAC 1 cut(s) 63
CviAII CATG 2 cut(s) 32, 107
CviJI RGCY 7 cut(s) 79, 119, 198, 250, 263, 295, 306
CviKI_1 RGCY 7 cut(s) 79, 119, 198, 250, 263, 295, 306
CviQI GTAC 1 cut(s) 63
DdeI CTNAG 1 cut(s) 84
DpnI GATC 2 cut(s) 153, 219
DpnII GATC 2 cut(s) 151, 217
Eam1104I CTCTTC 1 cut(s) 166
EarI CTCTTC 1 cut(s) 166
Eco147I AGGCCT 1 cut(s) 306
Eco24I GRGCYC 1 cut(s) 252
Eco47I GGWCC 1 cut(s) 201
Eco57I CTGAAG 2 cut(s) 30, 39
EcoRII CCWGG 1 cut(s) 243
EcoT38I GRGCYC 1 cut(s) 252
FaeI CATG 2 cut(s) 35, 110
FaiI YATR 8 cut(s) 33, 108, 213, 254, 290, 292, 310, 312
FalI AAGNNNNNCTT 2 cut(s) 28, 60
FatI CATG 2 cut(s) 31, 106
FbaI TGATCA 1 cut(s) 151
FriOI GRGCYC 1 cut(s) 252
FspBI CTAG 1 cut(s) 316
HaeIII GGCC 1 cut(s) 306
Hin1II CATG 2 cut(s) 35, 110
HincII GTYRAC 1 cut(s) 41
HindII GTYRAC 1 cut(s) 41
HphI GGTGA 1 cut(s) 161
Hpy166II GTNNAC 1 cut(s) 41
Hpy188I TCNGA 2 cut(s) 49, 58
Hpy8I GTNNAC 1 cut(s) 41
HpyAV CCTTC 2 cut(s) 54, 296
HpyCH4IV ACGT 1 cut(s) 209
HpyF10VI GCNNNNNNNGC 1 cut(s) 116
HpyF3I CTNAG 1 cut(s) 84
HpySE526I ACGT 1 cut(s) 209
Hsp92II CATG 2 cut(s) 35, 110
Ksp22I TGATCA 1 cut(s) 151
Kzo9I GATC 2 cut(s) 151, 217
LguI GCTCTTC 1 cut(s) 166
LmnI GCTCC 1 cut(s) 247
LpnPI CCDG 4 cut(s) 110, 184, 230, 257
LweI GCATC 1 cut(s) 40
MaeI CTAG 1 cut(s) 316
MaeII ACGT 1 cut(s) 209
MalI GATC 2 cut(s) 153, 219
MboI GATC 2 cut(s) 151, 217
MboII GAAGA 3 cut(s) 183, 212, 311
MflI RGATCY 1 cut(s) 217
MhlI GDGCHC 2 cut(s) 178, 252
MluCI AATT 1 cut(s) 25
MnlI CCTC 1 cut(s) 208
MseI TTAA 1 cut(s) 227
MspR9I CCNGG 1 cut(s) 245
MvaI CCWGG 1 cut(s) 245
MwoI GCNNNNNNNGC 1 cut(s) 116
NdeII GATC 2 cut(s) 151, 217
NlaIII CATG 2 cut(s) 35, 110
NlaIV GGNNCC 1 cut(s) 249
NmeAIII GCCGAG 1 cut(s) 136
PceI AGGCCT 1 cut(s) 306
PciSI GCTCTTC 1 cut(s) 166
PfoI TCCNGGA 1 cut(s) 243
Psp6I CCWGG 1 cut(s) 243
PspGI CCWGG 1 cut(s) 243
PspN4I GGNNCC 1 cut(s) 249
PspPI GGNCC 1 cut(s) 201
PsuI RGATCY 1 cut(s) 217
RsaI GTAC 1 cut(s) 64
RsaNI GTAC 1 cut(s) 63
SapI GCTCTTC 1 cut(s) 166
SaqAI TTAA 1 cut(s) 227
Sau3AI GATC 2 cut(s) 151, 217
Sau96I GGNCC 1 cut(s) 201
ScaI AGTACT 1 cut(s) 64
ScrFI CCNGG 1 cut(s) 245
SduI GDGCHC 2 cut(s) 178, 252
SetI ASST 7 cut(s) 46, 121, 200, 212, 241, 259, 265
SfaNI GCATC 1 cut(s) 40
SinI GGWCC 1 cut(s) 201
Sse9I AATT 1 cut(s) 25
SseBI AGGCCT 1 cut(s) 306
SspMI CTAG 1 cut(s) 316
StuI AGGCCT 1 cut(s) 306
StyD4I CCNGG 1 cut(s) 243
TaiI ACGT 1 cut(s) 212
TaqI TCGA 1 cut(s) 297
TasI AATT 1 cut(s) 25
TatI WGTACW 1 cut(s) 62
Tru1I TTAA 1 cut(s) 227
Tru9I TTAA 1 cut(s) 227
TspDTI ATGAA 1 cut(s) 48
VpaK11BI GGWCC 1 cut(s) 201
XcmI CCANNNNNNNNNTGG 1 cut(s) 195
XspI CTAG 1 cut(s) 316
ZrmI AGTACT 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.