Rmu_sc0003902.1_g000026

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003902.1
Physical Location & Seq
Forward (+)
106148 .. 106804
657 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003902.1_g000026.1.cds

Sequence Viewer

Length: 300 bp
atgcagggaaaacaggagatatctgagttggattttgcaactgaaattctcccaaaatgtatcaagatcttagcagtgacagggactaatggaaaatcaactgttgtcacttttgctggacagatgcttaatcatttgggtatcaacacatttttggggggtaatcttggaaatccactctcagaggctgcgttccattgcttacagaacccccttctaaaaccaaagtttaaggttgctgtggtggaggttagcagttaccaaatggaaattccaacaagtacttctgcccttctgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

10.61

Weight (kDa)

6.71

Isoelectric Point (pI)

22.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016410)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 45, 270
AfaI GTAC 1 cut(s) 283
AjuI GAANNNNNNNTTGG 4 cut(s) 255, 268, 287, 300
AlwNI CAGNNNCTG 1 cut(s) 188
ApeKI GCWGC 1 cut(s) 188
ApoI RAATTY 2 cut(s) 45, 270
BbvI GCAGC 1 cut(s) 175
BfmI CTRYAG 1 cut(s) 296
BglII AGATCT 1 cut(s) 66
BisI GCNGC 1 cut(s) 189
BlsI GCNGC 1 cut(s) 190
BmcAI AGTACT 1 cut(s) 283
BmsI GCATC 1 cut(s) 114
Bse3DI GCAATG 1 cut(s) 196
BseMI GCAATG 1 cut(s) 196
BseMII CTCAG 2 cut(s) 15, 195
BseXI GCAGC 1 cut(s) 175
BslFI GGGAC 1 cut(s) 97
BsmFI GGGAC 1 cut(s) 97
Bsp143I GATC 1 cut(s) 66
BspCNI CTCAG 2 cut(s) 16, 194
BsrDI GCAATG 1 cut(s) 196
BssMI GATC 1 cut(s) 66
Bst4CI ACNGT 1 cut(s) 103
BstDEI CTNAG 3 cut(s) 24, 70, 181
BstKTI GATC 1 cut(s) 69
BstMBI GATC 1 cut(s) 66
BstSFI CTRYAG 1 cut(s) 296
BstV1I GCAGC 1 cut(s) 175
BstX2I RGATCY 1 cut(s) 66
BstYI RGATCY 1 cut(s) 66
BtsI GCAGTG 1 cut(s) 81
BtsIMutI CAGTG 1 cut(s) 81
CaiI CAGNNNCTG 1 cut(s) 188
Csp6I GTAC 1 cut(s) 282
CviJI RGCY 1 cut(s) 188
CviKI_1 RGCY 1 cut(s) 188
CviQI GTAC 1 cut(s) 282
DdeI CTNAG 3 cut(s) 24, 70, 181
DpnI GATC 1 cut(s) 68
DpnII GATC 1 cut(s) 66
Eco32I GATATC 1 cut(s) 21
EcoRV GATATC 1 cut(s) 21
FaqI GGGAC 1 cut(s) 97
Fnu4HI GCNGC 1 cut(s) 189
Fsp4HI GCNGC 1 cut(s) 189
GluI GCNGC 1 cut(s) 189
Hpy188I TCNGA 2 cut(s) 25, 184
Hpy188III TCNNGA 1 cut(s) 64
HpyAV CCTTC 1 cut(s) 224
HpyCH4III ACNGT 1 cut(s) 103
HpyCH4V TGCA 2 cut(s) 4, 38
HpyF3I CTNAG 3 cut(s) 24, 70, 181
Kzo9I GATC 1 cut(s) 66
LpnPI CCDG 2 cut(s) 66, 102
Lsp1109I GCAGC 1 cut(s) 175
LweI GCATC 1 cut(s) 114
MaeIII GTNAC 3 cut(s) 76, 106, 257
MalI GATC 1 cut(s) 68
MboI GATC 1 cut(s) 66
MflI RGATCY 1 cut(s) 66
MluCI AATT 2 cut(s) 45, 270
MmeI TCCRAC 2 cut(s) 9, 299
MnlI CCTC 2 cut(s) 178, 241
MseI TTAA 2 cut(s) 129, 231
NdeII GATC 1 cut(s) 66
NmuCI GTSAC 2 cut(s) 76, 106
PkrI GCNGC 1 cut(s) 190
PstNI CAGNNNCTG 1 cut(s) 188
PsuI RGATCY 1 cut(s) 66
RsaI GTAC 1 cut(s) 283
RsaNI GTAC 1 cut(s) 282
SaqAI TTAA 2 cut(s) 129, 231
SatI GCNGC 1 cut(s) 189
Sau3AI GATC 1 cut(s) 66
ScaI AGTACT 1 cut(s) 283
SetI ASST 2 cut(s) 237, 252
SfaNI GCATC 1 cut(s) 114
SfcI CTRYAG 1 cut(s) 296
SgeI CNNG 7 cut(s) 17, 26, 76, 93, 129, 179, 291
Sse9I AATT 2 cut(s) 45, 270
TaaI ACNGT 1 cut(s) 103
TasI AATT 2 cut(s) 45, 270
TatI WGTACW 1 cut(s) 281
Tru1I TTAA 2 cut(s) 129, 231
Tru9I TTAA 2 cut(s) 129, 231
TscAI CASTG 1 cut(s) 81
TseFI GTSAC 2 cut(s) 76, 106
TseI GCWGC 1 cut(s) 188
Tsp45I GTSAC 2 cut(s) 76, 106
TspRI CASTG 1 cut(s) 81
XapI RAATTY 2 cut(s) 45, 270
ZrmI AGTACT 1 cut(s) 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.