Rorug03G0185000

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Forward (+)
15974631 .. 15976195
1565 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0185000.1

Sequence Viewer

Length: 411 bp
ATGGAAATTTTCTGCAAAAGCTGGTTGCCAAAACCAGGTGATCAAATCAAAGCTGGCTTATGTTTCTGCCATGGGTACGGTAGTACTTGCACATTCTTCTTTGAAGGTATTGCTAGGAGAATTGCTCAGTCTGGGTACGCTGTGTATGCAGTAGACTATCCAGGTTTTGGTCTTTCTGAAGGGTTGCATGGTTTCATCCCAGACTTTGATGAGTTGGTTGATGATGTTATTGAACAATTTACTAGTATCAAAGGAAGATCTGAAGTGAAAGGTTTGCCCTTTTTTATAATGGGGGGGTCGGTGGGTGGAGCTGTCACTCTAAAGATTCATCTAAAGGAACCGCATGAATGGGATGGAGTGATCCTTGTAGGTCCAATGTGTAAAGTAATTATTAAAAAAAGAAAGAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

136

Amino Acids

15.05

Weight (kDa)

7.64

Isoelectric Point (pI)

36.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Hydrolase_4 PF12146 15 - 129 7.6e-32 Serine aminopeptidase, S33
Abhydrolase_1 PF00561 20 - 127 9.4e-10 alpha/beta hydrolase fold
Abhydrolase_6 PF12697 22 - 125 1.1e-08 Alpha/beta hydrolase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016410)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 287
AccB7I CCANNNNNTGG 1 cut(s) 167
AccI GTMKAC 1 cut(s) 153
AciI CCGC 1 cut(s) 341
AclWI GGATC 1 cut(s) 355
AcsI RAATTY 1 cut(s) 6
AcuI CTGAAG 2 cut(s) 198, 282
AfaI GTAC 3 cut(s) 77, 85, 137
AfiI CCNNNNNNNGG 2 cut(s) 35, 167
AgsI TTSAA 2 cut(s) 104, 233
AhlI ACTAGT 1 cut(s) 242
AjnI CCWGG 2 cut(s) 34, 160
AluBI AGCT 3 cut(s) 21, 53, 311
AluI AGCT 3 cut(s) 21, 53, 311
AlwI GGATC 1 cut(s) 355
ApoI RAATTY 1 cut(s) 6
AspS9I GGNCC 1 cut(s) 371
AsuHPI GGTGA 1 cut(s) 50
AvaII GGWCC 1 cut(s) 371
BaeI ACNNNNGTAYC 2 cut(s) 67, 100
BccI CCATC 1 cut(s) 347
BciT130I CCWGG 2 cut(s) 36, 162
BclI TGATCA 1 cut(s) 40
BcuI ACTAGT 1 cut(s) 242
BfaI CTAG 2 cut(s) 114, 243
BglII AGATCT 1 cut(s) 257
BmcAI AGTACT 1 cut(s) 85
Bme1390I CCNGG 2 cut(s) 36, 162
Bme18I GGWCC 1 cut(s) 371
BmgT120I GGNCC 1 cut(s) 371
BmiI GGNNCC 1 cut(s) 339
BmrFI CCNGG 2 cut(s) 36, 162
BplI GAGNNNNNCTC 2 cut(s) 109, 141
BsaJI CCNNGG 1 cut(s) 70
Bsc4I CCNNNNNNNGG 2 cut(s) 35, 167
BseBI CCWGG 2 cut(s) 36, 162
BseDI CCNNGG 1 cut(s) 70
BseGI GGATG 2 cut(s) 195, 358
BseLI CCNNNNNNNGG 2 cut(s) 35, 167
BseMII CTCAG 1 cut(s) 140
BslI CCNNNNNNNGG 2 cut(s) 35, 167
Bsp143I GATC 3 cut(s) 40, 257, 360
Bsp19I CCATGG 1 cut(s) 70
BspACI CCGC 1 cut(s) 341
BspCNI CTCAG 1 cut(s) 139
BspLI GGNNCC 1 cut(s) 339
BspPI GGATC 1 cut(s) 355
BssECI CCNNGG 1 cut(s) 70
BssMI GATC 3 cut(s) 40, 257, 360
BssT1I CCWWGG 1 cut(s) 70
Bst2UI CCWGG 2 cut(s) 36, 162
Bst4CI ACNGT 1 cut(s) 80
BstC8I GCNNGC 1 cut(s) 55
BstDEI CTNAG 1 cut(s) 126
BstDSI CCRYGG 1 cut(s) 70
BstF5I GGATG 2 cut(s) 195, 358
BstKTI GATC 3 cut(s) 43, 260, 363
BstMBI GATC 3 cut(s) 40, 257, 360
BstMWI GCNNNNNNNGC 1 cut(s) 146
BstNI CCWGG 2 cut(s) 36, 162
BstSCI CCNGG 2 cut(s) 34, 160
BstX2I RGATCY 1 cut(s) 257
BstYI RGATCY 1 cut(s) 257
BtgI CCRYGG 1 cut(s) 70
BtsCI GGATG 2 cut(s) 195, 358
Cac8I GCNNGC 1 cut(s) 55
Cfr13I GGNCC 1 cut(s) 371
CsiI ACCWGGT 1 cut(s) 34
Csp6I GTAC 3 cut(s) 76, 84, 136
CviAII CATG 3 cut(s) 71, 188, 344
CviJI RGCY 4 cut(s) 21, 53, 57, 311
CviKI_1 RGCY 4 cut(s) 21, 53, 57, 311
CviQI GTAC 3 cut(s) 76, 84, 136
DdeI CTNAG 1 cut(s) 126
DpnI GATC 3 cut(s) 42, 259, 362
DpnII GATC 3 cut(s) 40, 257, 360
Eco130I CCWWGG 1 cut(s) 70
Eco47I GGWCC 1 cut(s) 371
Eco57I CTGAAG 2 cut(s) 198, 282
EcoRII CCWGG 2 cut(s) 34, 160
EcoT14I CCWWGG 1 cut(s) 70
ErhI CCWWGG 1 cut(s) 70
FaeI CATG 3 cut(s) 74, 191, 347
FaiI YATR 6 cut(s) 61, 72, 147, 189, 287, 345
FatI CATG 3 cut(s) 70, 187, 343
FbaI TGATCA 1 cut(s) 40
FblI GTMKAC 1 cut(s) 153
FokI GGATG 2 cut(s) 182, 365
FspBI CTAG 2 cut(s) 114, 243
Hin1II CATG 3 cut(s) 74, 191, 347
HinfI GANTC 1 cut(s) 325
HphI GGTGA 1 cut(s) 50
Hpy166II GTNNAC 1 cut(s) 154
Hpy188I TCNGA 2 cut(s) 178, 262
Hpy8I GTNNAC 1 cut(s) 154
HpyAV CCTTC 2 cut(s) 98, 173
HpyCH4III ACNGT 1 cut(s) 80
HpyCH4V TGCA 4 cut(s) 15, 90, 149, 187
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
HpyF3I CTNAG 1 cut(s) 126
Hsp92II CATG 3 cut(s) 74, 191, 347
Ksp22I TGATCA 1 cut(s) 40
Kzo9I GATC 3 cut(s) 40, 257, 360
LmnI GCTCC 1 cut(s) 308
LpnPI CCDG 8 cut(s) 7, 21, 39, 48, 117, 147, 174, 213
MabI ACCWGGT 1 cut(s) 34
MaeI CTAG 2 cut(s) 114, 243
MaeIII GTNAC 1 cut(s) 313
MalI GATC 3 cut(s) 42, 259, 362
MboI GATC 3 cut(s) 40, 257, 360
MboII GAAGA 2 cut(s) 88, 267
MflI RGATCY 1 cut(s) 257
MluCI AATT 4 cut(s) 6, 120, 236, 387
MseI TTAA 1 cut(s) 393
MspR9I CCNGG 2 cut(s) 36, 162
MvaI CCWGG 2 cut(s) 36, 162
MwoI GCNNNNNNNGC 1 cut(s) 146
NcoI CCATGG 1 cut(s) 70
NdeII GATC 3 cut(s) 40, 257, 360
NlaIII CATG 3 cut(s) 74, 191, 347
NlaIV GGNNCC 1 cut(s) 339
NmuCI GTSAC 1 cut(s) 313
PfeI GAWTC 1 cut(s) 325
PflMI CCANNNNNTGG 1 cut(s) 167
PsiI TTATAA 1 cut(s) 287
Psp6I CCWGG 2 cut(s) 34, 160
PspGI CCWGG 2 cut(s) 34, 160
PspN4I GGNNCC 1 cut(s) 339
PspPI GGNCC 1 cut(s) 371
PsuI RGATCY 1 cut(s) 257
RsaI GTAC 3 cut(s) 77, 85, 137
RsaNI GTAC 3 cut(s) 76, 84, 136
SaqAI TTAA 1 cut(s) 393
Sau3AI GATC 3 cut(s) 40, 257, 360
Sau96I GGNCC 1 cut(s) 371
ScaI AGTACT 1 cut(s) 85
ScrFI CCNGG 2 cut(s) 36, 162
SetI ASST 8 cut(s) 23, 40, 55, 109, 166, 274, 313, 373
SexAI ACCWGGT 1 cut(s) 34
SinI GGWCC 1 cut(s) 371
SpeI ACTAGT 1 cut(s) 242
Sse9I AATT 4 cut(s) 6, 120, 236, 387
SsiI CCGC 1 cut(s) 341
SspMI CTAG 2 cut(s) 114, 243
StyD4I CCNGG 2 cut(s) 34, 160
StyI CCWWGG 1 cut(s) 70
TaaI ACNGT 1 cut(s) 80
TasI AATT 4 cut(s) 6, 120, 236, 387
TatI WGTACW 1 cut(s) 83
TfiI GAWTC 1 cut(s) 325
Tru1I TTAA 1 cut(s) 393
Tru9I TTAA 1 cut(s) 393
TseFI GTSAC 1 cut(s) 313
Tsp45I GTSAC 1 cut(s) 313
TspDTI ATGAA 3 cut(s) 184, 317, 360
Van91I CCANNNNNTGG 1 cut(s) 167
VpaK11BI GGWCC 1 cut(s) 371
XapI RAATTY 1 cut(s) 6
XmiI GTMKAC 1 cut(s) 153
XspI CTAG 2 cut(s) 114, 243
ZrmI AGTACT 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.