Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003949.1

Orthogroup ID

OG0006706

Physical Location & Seq

Genomic Coordinates Reverse (-)

22883 .. 24993

Gene Structure 2111 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003949.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 774 bp

atggcaaaaaccaaggttatcaacagttgccttaatcctgtttggaatgaagagctaagcttctatcctacagaacccatcggagttctaaatctggaagtgtttgacaaagacttcctcaagacggatgataagatgggacatgctcacctgagccttcagccaatagtctcggctgctagattggggcaaatattacgagtttcttcttctggtgagacaacattaaggaaggttgtcccagatagtgacaactgcctagttagggaaagcaccataaattgtatagatggcgaggtggtgcagagtgtttggttgaggctttgtgatgtcgagtctggggaaatagaattgaaaatcaagttgtctggtgcgcctatggcaaaaaccaaggttatcaacagttgccttaatcctgtttggaatgaagagctaagcttctatcctacagaacccatcggagttctaaatctggaagtgtttgacaaagacttcctcaagacggatgataagatgggacatgctcacctgagccttcagccaatagtctcggctgctagattggggcaaatattacgagtttcttcttctggtgagacaacattaaggaaggttgtcccagatagtgacaactgcctagttagggaaagcaccataaattgtatagatggcgaggtggtgcagagtgtttggttgaggctttgtgatgtcgagtctggggaaatagaattgaaaatcaagttgtctggtgcgcctgttgctccctcacggtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005096 GO:0005488 GO:0005543 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005773 GO:0005886 GO:0007275 GO:0008047 GO:0008150 GO:0008289 GO:0009555 GO:0009787 GO:0009789 GO:0009966 GO:0009967 GO:0010646 GO:0010647 GO:0016020 GO:0023051 GO:0023056 GO:0030234 GO:0030695 GO:0032501 GO:0032502 GO:0043085 GO:0043087 GO:0043167 GO:0043168 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043547 GO:0044093 GO:0044424 GO:0044444 GO:0044464 GO:0048229 GO:0048518 GO:0048522 GO:0048583 GO:0048584 GO:0048856 GO:0050789 GO:0050790 GO:0050794 GO:0051336 GO:0051345 GO:0060589 GO:0065007 GO:0065009 GO:0071944 GO:0098772 GO:1901419 GO:1901421 GO:1905957 GO:1905959

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Protein Analysis

257

Amino Acids

28.32

Weight (kDa)

5.06

Isoelectric Point (pI)

53.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006706)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G47710 AT5G47710 AT5G47710 AT5G47710
fragaria_vesca	FvH4_3g00301 FvH4_3g00301 FvH4_3g00301
malus_domestica	MD05G1361900.v1.1 MD10G1339400.v1.1
prunus_persica	Prupe.4G003500_v2.0.a1 Prupe.4G003500_v2.0.a1
pyrus_communis	pycom05g32840
rosa_chinensis	RchiOBHm_Chr5g0000471
rosa_laevigata	RLG00000030870
rosa_multiflora	Rmu_sc0003949.1_g000007
rosa_rugosa	Rorug04G0383900 Rorug04G0384000 Rorug04G0384100 Rorug04G0384200 Rorug04G0384200 Rorug04G0384200
rosa_samantha	Rh5AG003900 Rh5BG005100 Rh5CG004200 Rh5DG004100
rosa_wichuraiana	Rw5G000390

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	2 cut(s)	143, 521
AfiI	CCNNNNNNNGG	4 cut(s)	124, 265, 502, 643
AgsI	TTSAA	2 cut(s)	355, 733
AluBI	AGCT	4 cut(s)	55, 60, 433, 438
AluI	AGCT	4 cut(s)	55, 60, 433, 438
Alw26I	GTCTC	4 cut(s)	175, 212, 553, 590
ApeKI	GCWGC	2 cut(s)	176, 554
AspLEI	GCGC	2 cut(s)	376, 754
AsuHPI	GGTGA	4 cut(s)	140, 227, 518, 605
BbvI	GCAGC	2 cut(s)	163, 541
BccI	CCATC	6 cut(s)	86, 130, 284, 464, 508, 662
BcoDI	GTCTC	4 cut(s)	175, 212, 553, 590
BfaI	CTAG	4 cut(s)	180, 260, 558, 638
BfmI	CTRYAG	2 cut(s)	69, 447
BisI	GCNGC	2 cut(s)	177, 555
BlpI	GCTNAGC	2 cut(s)	56, 434
BlsI	GCNGC	2 cut(s)	178, 556
Bpu10I	CCTNAGC	2 cut(s)	152, 530
Bpu1102I	GCTNAGC	2 cut(s)	56, 434
BpuEI	CTTGAG	2 cut(s)	104, 482
BsaJI	CCNNGG	2 cut(s)	12, 390
Bsc4I	CCNNNNNNNGG	4 cut(s)	124, 265, 502, 643
BseDI	CCNNGG	2 cut(s)	12, 390
BseGI	GGATG	2 cut(s)	133, 511
BseLI	CCNNNNNNNGG	4 cut(s)	124, 265, 502, 643
BseMII	CTCAG	2 cut(s)	143, 521
BseXI	GCAGC	2 cut(s)	163, 541
BsgI	GTGCAG	2 cut(s)	323, 701
BslFI	GGGAC	4 cut(s)	153, 224, 531, 602
BslI	CCNNNNNNNGG	4 cut(s)	124, 265, 502, 643
BsmAI	GTCTC	4 cut(s)	175, 212, 553, 590
BsmFI	GGGAC	4 cut(s)	153, 224, 531, 602
Bsp1720I	GCTNAGC	2 cut(s)	56, 434
BspCNI	CTCAG	2 cut(s)	144, 522
BspQI	GCTCTTC	2 cut(s)	45, 423
BssECI	CCNNGG	2 cut(s)	12, 390
BssT1I	CCWWGG	2 cut(s)	12, 390
Bst4CI	ACNGT	3 cut(s)	26, 404, 771
Bst6I	CTCTTC	2 cut(s)	45, 423
BstDEI	CTNAG	4 cut(s)	56, 152, 434, 530
BstF5I	GGATG	2 cut(s)	133, 511
BstHHI	GCGC	2 cut(s)	376, 754
BstMAI	GTCTC	4 cut(s)	175, 212, 553, 590
BstMWI	GCNNNNNNNGC	2 cut(s)	380, 758
BstNSI	RCATGY	2 cut(s)	146, 524
BstSFI	CTRYAG	2 cut(s)	69, 447
BstV1I	GCAGC	2 cut(s)	163, 541
BtsCI	GGATG	2 cut(s)	133, 511
CfoI	GCGC	2 cut(s)	376, 754
CviAII	CATG	2 cut(s)	143, 521
DdeI	CTNAG	4 cut(s)	56, 152, 434, 530
Eam1104I	CTCTTC	2 cut(s)	45, 423
EarI	CTCTTC	2 cut(s)	45, 423
Eco130I	CCWWGG	2 cut(s)	12, 390
Eco57I	CTGAAG	2 cut(s)	143, 521
EcoT14I	CCWWGG	2 cut(s)	12, 390
ErhI	CCWWGG	2 cut(s)	12, 390
FaeI	CATG	2 cut(s)	146, 524
FaiI	YATR	7 cut(s)	144, 278, 287, 380, 522, 656, 665
FaqI	GGGAC	4 cut(s)	153, 224, 531, 602
FatI	CATG	2 cut(s)	142, 520
Fnu4HI	GCNGC	2 cut(s)	177, 555
FokI	GGATG	2 cut(s)	140, 518
Fsp4HI	GCNGC	2 cut(s)	177, 555
FspBI	CTAG	4 cut(s)	180, 260, 558, 638
GlaI	GCGC	2 cut(s)	375, 753
GluI	GCNGC	2 cut(s)	177, 555
HhaI	GCGC	2 cut(s)	376, 754
Hin1II	CATG	2 cut(s)	146, 524
Hin6I	GCGC	2 cut(s)	374, 752
HinP1I	GCGC	2 cut(s)	374, 752
HindIII	AAGCTT	2 cut(s)	58, 436
HinfI	GANTC	2 cut(s)	335, 713
HphI	GGTGA	4 cut(s)	140, 227, 518, 605
Hpy188I	TCNGA	2 cut(s)	83, 461
Hpy188III	TCNNGA	4 cut(s)	95, 121, 473, 499
HpyAV	CCTTC	4 cut(s)	167, 226, 545, 604
HpyCH4III	ACNGT	3 cut(s)	26, 404, 771
HpyCH4V	TGCA	2 cut(s)	304, 682
HpyF10VI	GCNNNNNNNGC	2 cut(s)	380, 758
HpyF3I	CTNAG	4 cut(s)	56, 152, 434, 530
Hsp92II	CATG	2 cut(s)	146, 524
HspAI	GCGC	2 cut(s)	374, 752
LguI	GCTCTTC	2 cut(s)	45, 423
LmnI	GCTCC	1 cut(s)	766
Lsp1109I	GCAGC	2 cut(s)	163, 541
MaeI	CTAG	4 cut(s)	180, 260, 558, 638
MaeIII	GTNAC	2 cut(s)	248, 626
MboII	GAAGA	6 cut(s)	62, 198, 201, 440, 576, 579
MluCI	AATT	4 cut(s)	280, 350, 658, 728
MlyI	GAGTC	2 cut(s)	344, 722
MnlI	CCTC	6 cut(s)	128, 289, 312, 506, 667, 690
MseI	TTAA	4 cut(s)	33, 227, 411, 605
MwoI	GCNNNNNNNGC	2 cut(s)	380, 758
NlaIII	CATG	2 cut(s)	146, 524
NmeAIII	GCCGAG	2 cut(s)	152, 530
NmuCI	GTSAC	2 cut(s)	248, 626
NspI	RCATGY	2 cut(s)	146, 524
PciSI	GCTCTTC	2 cut(s)	45, 423
PkrI	GCNGC	2 cut(s)	178, 556
PleI	GAGTC	2 cut(s)	343, 721
PpsI	GAGTC	2 cut(s)	343, 721
SapI	GCTCTTC	2 cut(s)	45, 423
SaqAI	TTAA	4 cut(s)	33, 227, 411, 605
SatI	GCNGC	2 cut(s)	177, 555
SchI	GAGTC	2 cut(s)	344, 722
SfcI	CTRYAG	2 cut(s)	69, 447
SmlI	CTYRAG	2 cut(s)	119, 497
SmoI	CTYRAG	2 cut(s)	119, 497
Sse9I	AATT	4 cut(s)	280, 350, 658, 728
SspI	AATATT	2 cut(s)	195, 573
SspMI	CTAG	4 cut(s)	180, 260, 558, 638
StyI	CCWWGG	2 cut(s)	12, 390
TaaI	ACNGT	3 cut(s)	26, 404, 771
TaqI	TCGA	2 cut(s)	333, 711
TasI	AATT	4 cut(s)	280, 350, 658, 728
Tru1I	TTAA	4 cut(s)	33, 227, 411, 605
Tru9I	TTAA	4 cut(s)	33, 227, 411, 605
TseFI	GTSAC	2 cut(s)	248, 626
TseI	GCWGC	2 cut(s)	176, 554
Tsp45I	GTSAC	2 cut(s)	248, 626
TspDTI	ATGAA	2 cut(s)	63, 441
TspGWI	ACGGA	2 cut(s)	140, 518
XceI	RCATGY	2 cut(s)	146, 524
XspI	CTAG	4 cut(s)	180, 260, 558, 638

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.