Rmu_sc0005507.1_g000054

Belongs to the 'GDSL' lipolytic enzyme family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005507.1
Physical Location & Seq
Forward (+)
235020 .. 236021
1002 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005507.1_g000054.1.cds

Sequence Viewer

Length: 256 bp
atgggtagccaaaccatcagagcagctttggttctggtttttgtatttgcctttgcaattattggtggcaatgcacaagaatcaaccactcttgttccagccatcatcacatttggtgattctgcagtagatgtgggaaacaatgactacctcctaacaatttataaggccaattaccctccttatggaagagactttgtgaaccatcaagctactgggaggttttgcaatggaaaactagccaccgatatcactg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.12

Weight (kDa)

5.49

Isoelectric Point (pI)

18.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019806)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 165
AfiI CCNNNNNNNGG 1 cut(s) 185
AluBI AGCT 2 cut(s) 26, 212
AluI AGCT 2 cut(s) 26, 212
Alw26I GTCTC 1 cut(s) 186
AoxI GGCC 1 cut(s) 168
ApeKI GCWGC 1 cut(s) 23
AsuHPI GGTGA 1 cut(s) 128
BbvI GCAGC 1 cut(s) 35
BccI CCATC 3 cut(s) 23, 110, 213
BcoDI GTCTC 1 cut(s) 186
BfaI CTAG 1 cut(s) 239
BfmI CTRYAG 1 cut(s) 123
BisI GCNGC 1 cut(s) 24
BlsI GCNGC 1 cut(s) 25
BmrI ACTGGG 1 cut(s) 225
BmuI ACTGGG 1 cut(s) 225
Bsc4I CCNNNNNNNGG 1 cut(s) 185
Bse1I ACTGG 1 cut(s) 220
Bse3DI GCAATG 2 cut(s) 76, 235
BseLI CCNNNNNNNGG 1 cut(s) 185
BseMI GCAATG 2 cut(s) 76, 235
BseNI ACTGG 1 cut(s) 220
BseXI GCAGC 1 cut(s) 35
BshFI GGCC 1 cut(s) 170
BslI CCNNNNNNNGG 1 cut(s) 185
BsmAI GTCTC 1 cut(s) 186
BsnI GGCC 1 cut(s) 170
BspANI GGCC 1 cut(s) 170
BspMAI CTGCAG 1 cut(s) 127
BsrDI GCAATG 2 cut(s) 76, 235
BsrI ACTGG 1 cut(s) 220
Bst6I CTCTTC 1 cut(s) 184
BstMAI GTCTC 1 cut(s) 186
BstSFI CTRYAG 1 cut(s) 123
BstV1I GCAGC 1 cut(s) 35
BsuRI GGCC 1 cut(s) 170
BtsIMutI CAGTG 1 cut(s) 252
CviJI RGCY 6 cut(s) 9, 26, 101, 170, 212, 242
CviKI_1 RGCY 6 cut(s) 9, 26, 101, 170, 212, 242
Eam1104I CTCTTC 1 cut(s) 184
EarI CTCTTC 1 cut(s) 184
Eco32I GATATC 1 cut(s) 250
EcoRV GATATC 1 cut(s) 250
FaiI YATR 2 cut(s) 165, 186
Fnu4HI GCNGC 1 cut(s) 24
Fsp4HI GCNGC 1 cut(s) 24
FspBI CTAG 1 cut(s) 239
GluI GCNGC 1 cut(s) 24
HaeIII GGCC 1 cut(s) 170
HinfI GANTC 2 cut(s) 80, 119
HphI GGTGA 1 cut(s) 128
Hpy166II GTNNAC 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 20
Hpy8I GTNNAC 1 cut(s) 202
HpyCH4V TGCA 4 cut(s) 56, 74, 125, 228
LpnPI CCDG 3 cut(s) 20, 111, 201
Lsp1109I GCAGC 1 cut(s) 35
MaeI CTAG 1 cut(s) 239
MboII GAAGA 1 cut(s) 201
MluCI AATT 3 cut(s) 57, 159, 172
MnlI CCTC 3 cut(s) 161, 189, 213
PfeI GAWTC 2 cut(s) 80, 119
PkrI GCNGC 1 cut(s) 25
PsiI TTATAA 1 cut(s) 165
PstI CTGCAG 1 cut(s) 127
SatI GCNGC 1 cut(s) 24
SetI ASST 4 cut(s) 28, 153, 214, 224
SfcI CTRYAG 1 cut(s) 123
SgeI CNNG 7 cut(s) 47, 89, 104, 110, 221, 228, 251
Sse9I AATT 3 cut(s) 57, 159, 172
SspMI CTAG 1 cut(s) 239
TasI AATT 3 cut(s) 57, 159, 172
TfiI GAWTC 2 cut(s) 80, 119
TseI GCWGC 1 cut(s) 23
XcmI CCANNNNNNNNNTGG 1 cut(s) 212
XspI CTAG 1 cut(s) 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.