Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005979.1

Orthogroup ID

OG0020819

Physical Location & Seq

Genomic Coordinates Forward (+)

94001 .. 94609

Gene Structure 609 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005979.1_g000024.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 609 bp

atgtttgctgacaattgtttaatctttggcagggccactttgtctgctgcaaataacttaaagactattctaaccagatttgccaaagcctctggacagaagatcaacttggataagtcttcgatctatttctctaataaaattttggccaatagaaaagttgttatttctaatatccttgggatcaaacacagatctaccattggtaaatatttgggtatccataacattattttttggaaagagccagtgtatgctaaggaattattactcaaagtaactaacaagcttagtggttggaagagttctactttgtctacagcagggaaactaaccttgatcaaatctaatattttgggaattcctaatcatgttatgtcacgtttcaaatgccctactaaggtaactaatgctttagataaagaagctagaaatttcttctgggggaaggatgtccattctcctccagttgcttggagtcaggtttgtcttcctaaatctgctagaggtcttggaattagacctgctgccttcttcaacaaggctgctttagctaaattggatggaaagtcctcaccaaccctaacaactggtgggttgagcttgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

202

Amino Acids

22.1

Weight (kDa)

10.43

Isoelectric Point (pI)

35.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020819)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0001301.1_g000071 Rmu_sc0005979.1_g000024 Rmu_sc0007912.1_g000003
rosa_roxburghii	Rroxscaffold_1G00045290 Rroxscaffold_4G00320980

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	532
AccI	GTMKAC	1 cut(s)	317
AclWI	GGATC	1 cut(s)	191
AcoI	YGGCCR	1 cut(s)	147
AcsI	RAATTY	3 cut(s)	141, 360, 433
AfiI	CCNNNNNNNGG	1 cut(s)	400
AgsI	TTSAA	2 cut(s)	388, 538
AjuI	GAANNNNNNNTTGG	2 cut(s)	92, 124
AluBI	AGCT	4 cut(s)	289, 428, 554, 603
AluI	AGCT	4 cut(s)	289, 428, 554, 603
AlwI	GGATC	1 cut(s)	191
AoxI	GGCC	2 cut(s)	33, 147
ApeKI	GCWGC	3 cut(s)	47, 527, 545
ApoI	RAATTY	3 cut(s)	141, 360, 433
AspS9I	GGNCC	1 cut(s)	33
AsuHPI	GGTGA	1 cut(s)	567
BalI	TGGCCA	1 cut(s)	149
BbsI	GAAGAC	2 cut(s)	111, 482
BbvI	GCAGC	3 cut(s)	34, 514, 532
BccI	CCATC	1 cut(s)	557
BciVI	GTATCC	1 cut(s)	230
BclI	TGATCA	1 cut(s)	339
BfaI	CTAG	2 cut(s)	429, 504
BfmI	CTRYAG	1 cut(s)	318
BfuAI	ACCTGC	1 cut(s)	532
BfuI	GTATCC	1 cut(s)	230
BglII	AGATCT	1 cut(s)	194
BisI	GCNGC	3 cut(s)	48, 528, 546
BlsI	GCNGC	3 cut(s)	49, 529, 547
BmgT120I	GGNCC	1 cut(s)	33
BpiI	GAAGAC	2 cut(s)	111, 482
BpmI	CTGGAG	1 cut(s)	450
Bpu10I	CCTNAGC	1 cut(s)	258
BsaJI	CCNNGG	1 cut(s)	178
Bsc4I	CCNNNNNNNGG	1 cut(s)	400
Bse1I	ACTGG	3 cut(s)	248, 467, 595
BseDI	CCNNGG	1 cut(s)	178
BseGI	GGATG	2 cut(s)	457, 568
BseLI	CCNNNNNNNGG	1 cut(s)	400
BseNI	ACTGG	3 cut(s)	248, 467, 595
BseRI	GAGGAG	1 cut(s)	453
BseXI	GCAGC	3 cut(s)	34, 514, 532
BshFI	GGCC	2 cut(s)	35, 149
BslI	CCNNNNNNNGG	1 cut(s)	400
BsnI	GGCC	2 cut(s)	35, 149
Bsp143I	GATC	5 cut(s)	102, 123, 183, 194, 339
BspANI	GGCC	2 cut(s)	35, 149
BspMI	ACCTGC	1 cut(s)	532
BspPI	GGATC	1 cut(s)	191
BsrI	ACTGG	3 cut(s)	248, 467, 595
BssECI	CCNNGG	1 cut(s)	178
BssMI	GATC	5 cut(s)	102, 123, 183, 194, 339
BssT1I	CCWWGG	1 cut(s)	178
Bst6I	CTCTTC	1 cut(s)	296
BstDEI	CTNAG	3 cut(s)	258, 290, 399
BstF5I	GGATG	2 cut(s)	457, 568
BstKTI	GATC	5 cut(s)	105, 126, 186, 197, 342
BstMBI	GATC	5 cut(s)	102, 123, 183, 194, 339
BstMWI	GCNNNNNNNGC	1 cut(s)	551
BstSFI	CTRYAG	1 cut(s)	318
BstV1I	GCAGC	3 cut(s)	34, 514, 532
BstV2I	GAAGAC	2 cut(s)	111, 482
BstX2I	RGATCY	1 cut(s)	194
BstXI	CCANNNNNNTGG	1 cut(s)	474
BstYI	RGATCY	1 cut(s)	194
BsuI	GTATCC	1 cut(s)	230
BsuRI	GGCC	2 cut(s)	35, 149
BtsCI	GGATG	2 cut(s)	457, 568
BtsIMutI	CAGTG	1 cut(s)	255
BveI	ACCTGC	1 cut(s)	532
Cfr13I	GGNCC	1 cut(s)	33
CspCI	CAANNNNNGTGG	2 cut(s)	274, 309
CviAII	CATG	1 cut(s)	371
CviJI	RGCY	9 cut(s)	35, 89, 149, 247, 289, 428, 545, 554, 603
CviKI_1	RGCY	9 cut(s)	35, 89, 149, 247, 289, 428, 545, 554, 603
DdeI	CTNAG	3 cut(s)	258, 290, 399
DpnI	GATC	5 cut(s)	104, 125, 185, 196, 341
DpnII	GATC	5 cut(s)	102, 123, 183, 194, 339
EaeI	YGGCCR	1 cut(s)	147
Eam1104I	CTCTTC	1 cut(s)	296
EarI	CTCTTC	1 cut(s)	296
Eco130I	CCWWGG	1 cut(s)	178
EcoRI	GAATTC	1 cut(s)	360
EcoT14I	CCWWGG	1 cut(s)	178
ErhI	CCWWGG	1 cut(s)	178
FaeI	CATG	1 cut(s)	374
FaiI	YATR	4 cut(s)	225, 255, 372, 377
FalI	AAGNNNNNCTT	2 cut(s)	92, 124
FatI	CATG	1 cut(s)	370
FbaI	TGATCA	1 cut(s)	339
FblI	GTMKAC	1 cut(s)	317
Fnu4HI	GCNGC	3 cut(s)	48, 528, 546
FokI	GGATG	2 cut(s)	464, 575
Fsp4HI	GCNGC	3 cut(s)	48, 528, 546
FspBI	CTAG	2 cut(s)	429, 504
GluI	GCNGC	3 cut(s)	48, 528, 546
GsuI	CTGGAG	1 cut(s)	450
HaeIII	GGCC	2 cut(s)	35, 149
Hin1II	CATG	1 cut(s)	374
HindIII	AAGCTT	1 cut(s)	287
HinfI	GANTC	1 cut(s)	478
HphI	GGTGA	1 cut(s)	567
Hpy166II	GTNNAC	1 cut(s)	318
Hpy188III	TCNNGA	1 cut(s)	93
Hpy8I	GTNNAC	1 cut(s)	318
HpyAV	CCTTC	2 cut(s)	442, 541
HpyCH4IV	ACGT	1 cut(s)	382
HpyCH4V	TGCA	1 cut(s)	50
HpyF10VI	GCNNNNNNNGC	1 cut(s)	551
HpyF3I	CTNAG	3 cut(s)	258, 290, 399
HpySE526I	ACGT	1 cut(s)	382
Hsp92II	CATG	1 cut(s)	374
Ksp22I	TGATCA	1 cut(s)	339
Kzo9I	GATC	5 cut(s)	102, 123, 183, 194, 339
Lsp1109I	GCAGC	3 cut(s)	34, 514, 532
MaeI	CTAG	2 cut(s)	429, 504
MaeII	ACGT	1 cut(s)	382
MaeIII	GTNAC	3 cut(s)	277, 378, 403
MalI	GATC	5 cut(s)	104, 125, 185, 196, 341
MboI	GATC	5 cut(s)	102, 123, 183, 194, 339
MboII	GAAGA	6 cut(s)	111, 112, 313, 430, 482, 526
MfeI	CAATTG	1 cut(s)	13
MflI	RGATCY	1 cut(s)	194
MlsI	TGGCCA	1 cut(s)	149
MluCI	AATT	7 cut(s)	13, 141, 263, 360, 433, 516, 557
MluNI	TGGCCA	1 cut(s)	149
MlyI	GAGTC	1 cut(s)	487
MmeI	TCCRAC	1 cut(s)	278
MnlI	CCTC	4 cut(s)	100, 474, 500, 583
Mox20I	TGGCCA	1 cut(s)	149
MscI	TGGCCA	1 cut(s)	149
MseI	TTAA	2 cut(s)	20, 59
Msp20I	TGGCCA	1 cut(s)	149
MunI	CAATTG	1 cut(s)	13
MwoI	GCNNNNNNNGC	1 cut(s)	551
NdeII	GATC	5 cut(s)	102, 123, 183, 194, 339
NlaIII	CATG	1 cut(s)	374
NmuCI	GTSAC	1 cut(s)	378
PkrI	GCNGC	3 cut(s)	49, 529, 547
PleI	GAGTC	1 cut(s)	486
PpsI	GAGTC	1 cut(s)	486
PspPI	GGNCC	1 cut(s)	33
PsuI	RGATCY	1 cut(s)	194
SaqAI	TTAA	2 cut(s)	20, 59
SatI	GCNGC	3 cut(s)	48, 528, 546
Sau3AI	GATC	5 cut(s)	102, 123, 183, 194, 339
Sau96I	GGNCC	1 cut(s)	33
SchI	GAGTC	1 cut(s)	487
SfcI	CTRYAG	1 cut(s)	318
Sse9I	AATT	7 cut(s)	13, 141, 263, 360, 433, 516, 557
SspI	AATATT	2 cut(s)	212, 352
SspMI	CTAG	2 cut(s)	429, 504
StyI	CCWWGG	1 cut(s)	178
TaiI	ACGT	1 cut(s)	385
TaqI	TCGA	1 cut(s)	122
TasI	AATT	7 cut(s)	13, 141, 263, 360, 433, 516, 557
Tru1I	TTAA	2 cut(s)	20, 59
Tru9I	TTAA	2 cut(s)	20, 59
TscAI	CASTG	1 cut(s)	255
TseFI	GTSAC	1 cut(s)	378
TseI	GCWGC	3 cut(s)	47, 527, 545
Tsp45I	GTSAC	1 cut(s)	378
TspRI	CASTG	1 cut(s)	255
XapI	RAATTY	3 cut(s)	141, 360, 433
XmiI	GTMKAC	1 cut(s)	317
XspI	CTAG	2 cut(s)	429, 504

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.