Rroxscaffold_4G00320980

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0020819
Physical Location & Seq
Forward (+)
50029083 .. 50033698
4616 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00320980.1

Sequence Viewer

Length: 840 bp
ATGTTCTCAAATTTTAACAAAACCAAAGCGACTGATGGAGCAATGCCTGTTAAGCTTGATCTTGAAAAAGCTTATGACTATCTAAATTGGGACTATATTAGATGTTGTCTTGCTAGATTTGGTTTCCATTCTAGTTGGATTGAGATTGTAATTGAGAGCATTTCTTCTGTTTCTTTCTCTCTTATTATTAATGGGAAACAAGAGGGACTCTTTACCCCTTCTAGGGGCTTGAGACAGGGAGACCCTCTCTCCCCTTATATATTCATTCTTTGTATGGAACCACTTATAAGACATTTGAACAGTGCTTCTGTGAGAACAAAAAATCACATTGGTCTCCTCTCCTCTGCAGGAGGATTAAGAATTTCTAATTTGGTGTTTGCTGACGATTGTTTAATCTTTGGCAGGGCCATTTCGTCTACTGCAAATAACTTAAAGACTATTCTAACTAAATTTGCCAAAGCCTCTGGACAGAAGATTAACTTAGATATGTCTTCGATCTATTTCTCTAATAAAGTTTTGGCTAATAGAAAAGTTGTTATTTCTAATATCCTTGGGATCAAACACAGATCTACCATTGGTAAATATTTGGGTATCCATAACATTATTTTTTGGGAAGAACCAGTGAATGCTAAGGAATTGTTACTCAAAGTAACTAACAAGCTTAGTGGTTGGAAGAATTCTACTTTGTCTAGAGCTGGGAAACTAACCTTGATCAAATCTAATATTTCGGGAATTCCTAATCATGTTATGTCATGTTTCAAATGCGCTACTAAGGTAACTAATGCTTTAGATAAAGAAGCTAGAAATTTCTTCGGGGGAACGATGTCCATTCTCCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

279

Amino Acids

30.96

Weight (kDa)

9.77

Isoelectric Point (pI)

45.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_1 PF00078 14 - 198 9.1e-21 Reverse transcriptase (RNA-dependent DNA polymerase)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020819)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001301.1_g000071 Rmu_sc0005979.1_g000024 Rmu_sc0007912.1_g000003
rosa_roxburghii Rroxscaffold_1G00045290 Rroxscaffold_4G00320980

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 287
AccI GTMKAC 1 cut(s) 416
AclWI GGATC 1 cut(s) 563
AcsI RAATTY 6 cut(s) 10, 360, 449, 676, 732, 805
AfiI CCNNNNNNNGG 3 cut(s) 222, 223, 224
AgsI TTSAA 3 cut(s) 65, 298, 760
AluBI AGCT 5 cut(s) 55, 71, 661, 695, 800
AluI AGCT 5 cut(s) 55, 71, 661, 695, 800
Alw26I GTCTC 3 cut(s) 226, 234, 338
AlwI GGATC 1 cut(s) 563
AoxI GGCC 1 cut(s) 405
ApoI RAATTY 6 cut(s) 10, 360, 449, 676, 732, 805
AseI ATTAAT 1 cut(s) 189
AspLEI GCGC 1 cut(s) 767
AspS9I GGNCC 1 cut(s) 405
BbsI GAAGAC 1 cut(s) 483
BccI CCATC 1 cut(s) 29
BciVI GTATCC 1 cut(s) 602
BclI TGATCA 1 cut(s) 711
BcoDI GTCTC 3 cut(s) 226, 234, 338
BfaI CTAG 6 cut(s) 114, 132, 222, 690, 801, 838
BfmI CTRYAG 1 cut(s) 345
BfuI GTATCC 1 cut(s) 602
BglII AGATCT 1 cut(s) 566
BmgT120I GGNCC 1 cut(s) 405
BmiI GGNNCC 1 cut(s) 279
BpiI GAAGAC 1 cut(s) 483
BplI GAGNNNNNCTC 2 cut(s) 231, 263
Bpu10I CCTNAGC 1 cut(s) 630
BpuEI CTTGAG 1 cut(s) 250
BsaI GGTCTC 2 cut(s) 234, 338
BsaJI CCNNGG 1 cut(s) 550
BsaXI ACNNNNNCTCC 2 cut(s) 233, 263
Bsc4I CCNNNNNNNGG 3 cut(s) 222, 223, 224
Bse1I ACTGG 1 cut(s) 620
Bse3DI GCAATG 1 cut(s) 48
BseDI CCNNGG 1 cut(s) 550
BseLI CCNNNNNNNGG 3 cut(s) 222, 223, 224
BseMI GCAATG 1 cut(s) 48
BseNI ACTGG 1 cut(s) 620
BseRI GAGGAG 3 cut(s) 326, 331, 824
BseYI CCCAGC 1 cut(s) 695
BshFI GGCC 1 cut(s) 407
BslFI GGGAC 2 cut(s) 104, 219
BslI CCNNNNNNNGG 3 cut(s) 222, 223, 224
BsmAI GTCTC 3 cut(s) 226, 234, 338
BsmFI GGGAC 2 cut(s) 104, 219
BsmI GAATGC 1 cut(s) 631
BsnI GGCC 1 cut(s) 407
Bso31I GGTCTC 2 cut(s) 234, 338
Bsp143I GATC 5 cut(s) 58, 495, 555, 566, 711
BspANI GGCC 1 cut(s) 407
BspLI GGNNCC 1 cut(s) 279
BspMAI CTGCAG 1 cut(s) 349
BspPI GGATC 1 cut(s) 563
BspTNI GGTCTC 2 cut(s) 234, 338
BsrDI GCAATG 1 cut(s) 48
BsrI ACTGG 1 cut(s) 620
BssECI CCNNGG 1 cut(s) 550
BssMI GATC 5 cut(s) 58, 495, 555, 566, 711
BssT1I CCWWGG 1 cut(s) 550
Bst4CI ACNGT 1 cut(s) 302
BstDEI CTNAG 4 cut(s) 481, 630, 662, 771
BstHHI GCGC 1 cut(s) 767
BstKTI GATC 5 cut(s) 61, 498, 558, 569, 714
BstMAI GTCTC 3 cut(s) 226, 234, 338
BstMBI GATC 5 cut(s) 58, 495, 555, 566, 711
BstMWI GCNNNNNNNGC 1 cut(s) 52
BstSFI CTRYAG 1 cut(s) 345
BstV2I GAAGAC 1 cut(s) 483
BstX2I RGATCY 1 cut(s) 566
BstYI RGATCY 1 cut(s) 566
BsuI GTATCC 1 cut(s) 602
BsuRI GGCC 1 cut(s) 407
BtsIMutI CAGTG 2 cut(s) 307, 627
CfoI GCGC 1 cut(s) 767
Cfr13I GGNCC 1 cut(s) 405
CspCI CAANNNNNGTGG 2 cut(s) 646, 681
CviAII CATG 2 cut(s) 743, 753
CviJI RGCY 9 cut(s) 55, 71, 228, 407, 461, 521, 661, 695, 800
CviKI_1 RGCY 9 cut(s) 55, 71, 228, 407, 461, 521, 661, 695, 800
DdeI CTNAG 4 cut(s) 481, 630, 662, 771
DpnI GATC 5 cut(s) 60, 497, 557, 568, 713
DpnII GATC 5 cut(s) 58, 495, 555, 566, 711
Eco130I CCWWGG 1 cut(s) 550
Eco31I GGTCTC 2 cut(s) 234, 338
EcoRI GAATTC 2 cut(s) 676, 732
EcoT14I CCWWGG 1 cut(s) 550
ErhI CCWWGG 1 cut(s) 550
FaeI CATG 2 cut(s) 746, 756
FalI AAGNNNNNCTT 2 cut(s) 464, 496
FaqI GGGAC 2 cut(s) 104, 219
FatI CATG 2 cut(s) 742, 752
FbaI TGATCA 1 cut(s) 711
FblI GTMKAC 1 cut(s) 416
FspBI CTAG 6 cut(s) 114, 132, 222, 690, 801, 838
GlaI GCGC 1 cut(s) 766
GsaI CCCAGC 1 cut(s) 699
HaeIII GGCC 1 cut(s) 407
HhaI GCGC 1 cut(s) 767
Hin1II CATG 2 cut(s) 746, 756
Hin6I GCGC 1 cut(s) 765
HinP1I GCGC 1 cut(s) 765
HindIII AAGCTT 3 cut(s) 53, 69, 659
HinfI GANTC 1 cut(s) 207
Hpy166II GTNNAC 1 cut(s) 417
Hpy188III TCNNGA 4 cut(s) 62, 465, 690, 729
Hpy8I GTNNAC 1 cut(s) 417
HpyAV CCTTC 1 cut(s) 228
HpyCH4III ACNGT 1 cut(s) 302
HpyCH4V TGCA 2 cut(s) 347, 422
HpyF10VI GCNNNNNNNGC 1 cut(s) 52
HpyF3I CTNAG 4 cut(s) 481, 630, 662, 771
Hsp92II CATG 2 cut(s) 746, 756
HspAI GCGC 1 cut(s) 765
Ksp22I TGATCA 1 cut(s) 711
Kzo9I GATC 5 cut(s) 58, 495, 555, 566, 711
LmnI GCTCC 1 cut(s) 38
LpnPI CCDG 7 cut(s) 60, 221, 333, 388, 450, 633, 681
MaeI CTAG 6 cut(s) 114, 132, 222, 690, 801, 838
MaeIII GTNAC 3 cut(s) 639, 649, 775
MalI GATC 5 cut(s) 60, 497, 557, 568, 713
MboI GATC 5 cut(s) 58, 495, 555, 566, 711
MboII GAAGA 6 cut(s) 156, 483, 484, 626, 685, 802
MflI RGATCY 1 cut(s) 566
MlyI GAGTC 1 cut(s) 201
MmeI TCCRAC 2 cut(s) 116, 650
MnlI CCTC 6 cut(s) 196, 255, 344, 347, 352, 472
MseI TTAA 7 cut(s) 15, 51, 189, 356, 392, 431, 477
Mva1269I GAATGC 1 cut(s) 631
MwoI GCNNNNNNNGC 1 cut(s) 52
NdeII GATC 5 cut(s) 58, 495, 555, 566, 711
NlaIII CATG 2 cut(s) 746, 756
NlaIV GGNNCC 1 cut(s) 279
PctI GAATGC 1 cut(s) 631
PleI GAGTC 1 cut(s) 201
PpsI GAGTC 1 cut(s) 201
PshBI ATTAAT 1 cut(s) 189
PsiI TTATAA 1 cut(s) 287
PspFI CCCAGC 1 cut(s) 695
PspN4I GGNNCC 1 cut(s) 279
PspPI GGNCC 1 cut(s) 405
PstI CTGCAG 1 cut(s) 349
PsuI RGATCY 1 cut(s) 566
SaqAI TTAA 7 cut(s) 15, 51, 189, 356, 392, 431, 477
Sau3AI GATC 5 cut(s) 58, 495, 555, 566, 711
Sau96I GGNCC 1 cut(s) 405
SchI GAGTC 1 cut(s) 201
SetI ASST 7 cut(s) 57, 73, 663, 697, 710, 777, 802
SfcI CTRYAG 1 cut(s) 345
SmlI CTYRAG 1 cut(s) 229
SmoI CTYRAG 1 cut(s) 229
SspI AATATT 2 cut(s) 584, 724
SspMI CTAG 6 cut(s) 114, 132, 222, 690, 801, 838
StyI CCWWGG 1 cut(s) 550
TaaI ACNGT 1 cut(s) 302
TaqI TCGA 1 cut(s) 494
Tru1I TTAA 7 cut(s) 15, 51, 189, 356, 392, 431, 477
Tru9I TTAA 7 cut(s) 15, 51, 189, 356, 392, 431, 477
TscAI CASTG 2 cut(s) 307, 627
TspDTI ATGAA 1 cut(s) 253
TspRI CASTG 2 cut(s) 307, 627
VspI ATTAAT 1 cut(s) 189
XapI RAATTY 6 cut(s) 10, 360, 449, 676, 732, 805
XbaI TCTAGA 1 cut(s) 689
XmiI GTMKAC 1 cut(s) 416
XspI CTAG 6 cut(s) 114, 132, 222, 690, 801, 838
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.