Rroxscaffold_1G00045290

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0020819
Physical Location & Seq
Forward (+)
64289588 .. 64290462
875 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00045290.1

Sequence Viewer

Length: 228 bp
ATGGACGAAGTCGCCCCGTTTACTTTCTATATGCACACTGGAGGTTTTGTCATCAAAGATCAAAAAGGAACTTCGCTTGTTGTAGCAACTAAAAGCTTTGGGACTACCAATGTACCATTAGTTGAAGCAATGGCTCTAAGGAACAGTCTTGTACTTGCCAGACAACATGGATATACCAATATACAAGCAGAAGGAGACTCAAAGTTAGTCATTCATGCCAACTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

75

Amino Acids

8.19

Weight (kDa)

6.82

Isoelectric Point (pI)

39.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 15 - 72 9.2e-09 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020819)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001301.1_g000071 Rmu_sc0005979.1_g000024 Rmu_sc0007912.1_g000003
rosa_roxburghii Rroxscaffold_1G00045290 Rroxscaffold_4G00320980

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 114, 153
AgsI TTSAA 1 cut(s) 125
AluBI AGCT 1 cut(s) 96
AluI AGCT 1 cut(s) 96
Alw26I GTCTC 1 cut(s) 189
BaeI ACNNNNGTAYC 2 cut(s) 96, 129
BcoDI GTCTC 1 cut(s) 189
BfaI CTAG 1 cut(s) 226
BpmI CTGGAG 1 cut(s) 60
BsaXI ACNNNNNCTCC 2 cut(s) 33, 63
Bse1I ACTGG 1 cut(s) 43
Bse3DI GCAATG 1 cut(s) 135
BseMI GCAATG 1 cut(s) 135
BseNI ACTGG 1 cut(s) 43
BslFI GGGAC 1 cut(s) 115
BsmAI GTCTC 1 cut(s) 189
BsmFI GGGAC 1 cut(s) 115
Bsp143I GATC 1 cut(s) 58
BsrDI GCAATG 1 cut(s) 135
BsrI ACTGG 1 cut(s) 43
BssMI GATC 1 cut(s) 58
Bst4CI ACNGT 1 cut(s) 146
BstDEI CTNAG 1 cut(s) 137
BstKTI GATC 1 cut(s) 61
BstMAI GTCTC 1 cut(s) 189
BstMBI GATC 1 cut(s) 58
BtsIMutI CAGTG 1 cut(s) 36
Csp6I GTAC 2 cut(s) 113, 152
CviAII CATG 2 cut(s) 167, 215
CviJI RGCY 2 cut(s) 96, 134
CviKI_1 RGCY 2 cut(s) 96, 134
CviQI GTAC 2 cut(s) 113, 152
DdeI CTNAG 1 cut(s) 137
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
FaeI CATG 2 cut(s) 170, 218
FaiI YATR 6 cut(s) 30, 32, 168, 174, 182, 216
FaqI GGGAC 1 cut(s) 115
FatI CATG 2 cut(s) 166, 214
FspBI CTAG 1 cut(s) 226
GsuI CTGGAG 1 cut(s) 60
Hin1II CATG 2 cut(s) 170, 218
HindIII AAGCTT 1 cut(s) 94
HinfI GANTC 1 cut(s) 197
Hpy166II GTNNAC 1 cut(s) 21
Hpy8I GTNNAC 1 cut(s) 21
HpyAV CCTTC 1 cut(s) 185
HpyCH4III ACNGT 1 cut(s) 146
HpyCH4V TGCA 1 cut(s) 34
HpyF3I CTNAG 1 cut(s) 137
Hsp92II CATG 2 cut(s) 170, 218
Kzo9I GATC 1 cut(s) 58
LpnPI CCDG 2 cut(s) 24, 172
MaeI CTAG 1 cut(s) 226
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MlyI GAGTC 1 cut(s) 191
MnlI CCTC 1 cut(s) 35
NdeII GATC 1 cut(s) 58
NlaIII CATG 2 cut(s) 170, 218
PflFI GACNNNGTC 1 cut(s) 8
PleI GAGTC 1 cut(s) 191
PpsI GAGTC 1 cut(s) 191
PsyI GACNNNGTC 1 cut(s) 8
RsaI GTAC 2 cut(s) 114, 153
RsaNI GTAC 2 cut(s) 113, 152
Sau3AI GATC 1 cut(s) 58
SchI GAGTC 1 cut(s) 191
SetI ASST 2 cut(s) 46, 98
SgeI CNNG 8 cut(s) 28, 51, 89, 161, 167, 171, 179, 197
SspMI CTAG 1 cut(s) 226
TaaI ACNGT 1 cut(s) 146
TatI WGTACW 1 cut(s) 151
TscAI CASTG 1 cut(s) 43
TspDTI ATGAA 1 cut(s) 203
TspRI CASTG 1 cut(s) 43
Tth111I GACNNNGTC 1 cut(s) 8
XspI CTAG 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.