Rmu_sc0006218.1_g000011

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006218.1
Physical Location & Seq
Forward (+)
53227 .. 59651
6425 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006218.1_g000011.1.cds

Sequence Viewer

Length: 4890 bp
atgcctggtaacgaaattgaaggcaggatccacaaattgtatgagctagacaactattcccgtcaatctcaagttgcggatggtaattggcctggctttgtttacaatcagtggcaggaaaaacaaagagagatcagtgaacctctaagtttcagttcgaagaataacatccaactattagattctgtgagaggacatggcaatggatctctgaatgtgtcatttgatcaagactatacacacttgactcagagacctggattgtccaatattcaacccagacaccaacatctgaagacgaatgactatatgcttggacgagacattttgcaggcgagccacaatcaagttgagttttttggtgagagcacaggttttgttccacataatttagcatcacagagcttatctatccatcaatcagagcaagaaaatgcatcaggtgatagtcccaccctgacaaccaattcagaaaggtctgaaatcactgaagcttccaccgagattaactttgttggaaggcaacagcaatttgcgaggggccaacaaggcattctaccacatcattcaatgcagcagtcagggtacaatgaaatgcagttgttgcagcaacacctaatgtttaagcaactgcaagaacttcagaggcagcagcaactacagcagtttggtgattcaaggcaacagaattcagtaaatcagctctctgcagtcgctaagcaggctgctggggttcagttttcacctctcattaatggaacacctgttaacgaaacaccccaaatgttaatgaattgggtgcagcgaggtgcatctcctactggacaaaatgtatctaatagggttagtttttcacaagagcaaggtcagactttgcgctcaatgggtcaggctcctcagcagttcgatgtatccttatatggtactcctattgctagtggaaggggaaacatgagtcagtattccccccatctccagtctatgtctcaagattctgtaaatttgttgaccaagcctagcaatcaagtacagaagcctgctgcgcaggcatcagctttcagtaactcctttgtaggtgatcattgtactactccagatcaagttttcttgcctcaaggagctttcatatccaaacaaggctttcaggggaaaaatatgtttggacaagctactgttccgggtttaaattgtggatctaccttggggagcatccagcaagagaatgccttgctaacaaacacatctctgcaggaactcaatggaaagcaagagcgagatagttggcctggtatatctcaaagcaatacaatgcagcatggcccttcacaggggctggttcctctagatccaatggaagagaagattttgtttaatacagatgatagcctttgggatccttctttggtaaattgcaatgatattggtggtggagggttaggaagctggagtgcacttatgcagtctgctgtggcagattctagtagtgataccggtctacatgaggagtggagtggtttgagttttcagaatacagaattgtcttctggtaatcagccttcaaacatcttggacagtgagaagcaacaaggaagttgggctgataacaacctgcacagtgcctcttcctttagttcaaaatcttttcacatgcttaacgattccagtgttagttcgagcttccctggatttcagcagccaggcattcaatacaaaccagagcatagagaaagtctccaccaggatgaatctcatgaatccattcagaagtctcccaaaagtaatagtgaatggttggatcataaccctcgacatcaggttcaacagacactcgagcatttggacaacacatgggtcggtcaaagaaatgagcgctccgagtgtgatgcaccgcagcagagaatagacccatacggtattgctcaaccaagcagtaaaccagaaggtaatattaatgaagccatgtacaagaggaactctgatggtggtctgtggaagagggatgatgataccagggtaacttcattttcaagatcaactggacaattggagcaactccaatctagctcagaggatactctgagaagcagacaaaattcacatatgtttaacttcccttctgtgacaaatgcacacataaccaagacctatcaggaaaccagcgcacaagtccaagataacagtaagcttgattatgtgaagcgtatgttatctagcaacaaagaggaggatgagggcataggtgaaaaacagcgacaaatgagtaatagctcccctattattcagaactcttatgggagggacggaaaaacatatgaccagcaaagttgctaccaaaaggacaacacatatgactgtaagccagttgatatatctgctacagtaggcagatcagttggtcctagtggtgcccatttcacagctggaacaagtcaaaatatgctggaacttcttaacaaggttgacaggttgaatgagacgtctgttgcacagtttgatcccagtggatttaatccattatctgaggtgactgatgcaaaacctcctgtagcatctgttgatcaaatgtacaatcaatcttctgcttctcaaggttttactttgaaattggctcccccgtctcaacgacagtccaattcaaactctcagttctcccctcagagttcgctacaaccagcaaggcaaatggattcggattttggagaaaagagtcagacctacttggctacttcgccatcatctcaatctttatccagatcacatgaatcatcaccaagggctcgctgggatgataagtttagtattgggggacaatcaagcatctcccaatcttatatgcatgggaactctattgcagaaattacatcaagtcctacatttcgaaggaatcagcttcaaacacaagttttgtttaatccacatgcatcaggtccttctacacaggcaacgttacctgctactgccactggacatccacattcaaacctcgctcaatctcaagatactcctcagcaaacttttgtcaaccctgatggtcaacaattccctattctggaatctgtgccagtatctcatcctccttttatgacaggcatgcctccacagggtggagtttcgttcaggccgcagactttatggacaaataaagcaagtcagcaacatctttctggaatggaacctcaaaaggttcccacagtagttccttcaaatgatagtatggaaactacttcatcaactttgaaggagctaaatagtctaaattcccgacaaggtggtgggcatttacaaggcttcagttctccagaagagcagcattcgaaagagagggggcagaaaccaatgttttctggaatgcttgaggcttcacaaccaggggtaaggaatgtctctgatccaggtggcttgccttcgggttcattgttggctaattcgaacttacaggatcctgatagaatacataatggtgacaacaatggcttgtctcccacggcaagaaatctccaattcattggccatgctctaaatccgtcgcatggtcttcgtcaaaattactccctgctgcaccaggtgcaggcaatgaagaatatgatgaccgatccaagtaggagggatctggatgtacgacaggcaactgttatggcaggacagcagtccgtctatgatcagaataaggatggtgaactgaattctgcatcacatctcaagtcattaccacatggaaataccattgttccgagtttcttgtcagaagcaagagaagatccgagcataaaagcttcaccgcaatctgctcctcaagctcaagtgatggttgcatttggtgaaactgattctcagagtcaatctactggaagtaatgggacacctattcatgctgaagcttctcgggctaatctatttatggcagccaactggtttaagcagtatgggaatttcagaaatggacaggtgccactgatgcaggatgcaaggactgctgcagggcagttctcacttttcaagccttctcagagtccaaatatacattcttctgtggaccaaatagatgcttctgatgctaatcaaagcagcaaggtctggccaggtacggctgccaattttgtgccaaatgaaccattgatagctccttgcgggttgaattcaaatgccagcaaccaaagtatggatatcttgagaccaaagaaacgaaaaattgcaatttgtgaccaaccatggcacaaagtaacacaaggttccaaagaggttcaagatttcagtatggcagaagaagactgggcattggcgtccaatcggttgattgagaaagttccagatgagtttggaatgattgaagatgtaccgccaatctttcgagccaagagaagacttatctttacaacacagtttatgcagcatttgcttggccccgcaccagcatcttttctctcagcagatgctgctctgcactatgatagtgtgacatattttgtggccaagtcttccgtaggggatgcatgcagcctgacctgcagcaagaaagacagtactcttaagcaaatgaacaacagtaacatgattctggatcagccacaagtttctgagagtgatgatgaccagttcttttcaaaggttgtgggaaacttgacggatagatcaaagaagctggaaaatgaattattgaggttggacagggcagcatcaattttagatgtaagactggaatgtcaggagttggaaagattttccgtgataaaccgatttgcgaagttccatctcccccgagcagatatgtctggaacctcatcttcatcaggcacatttacaaatgcatctcgaccatgtccccaacgatatgtcactggacagccattgccaaagaatctaccagagggggtacagtgtctcacactgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

1629

Amino Acids

179.35

Weight (kDa)

5.8

Isoelectric Point (pI)

59.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 4698
AatII GACGTC 1 cut(s) 2480
Acc16I TGCGCA 1 cut(s) 1044
Acc36I ACCTGC 3 cut(s) 1617, 2959, 4511
AccB1I GGYRCC 2 cut(s) 2405, 3946
AccB7I CCANNNNNTGG 2 cut(s) 3104, 4159
AccI GTMKAC 1 cut(s) 1495
AciI CCGC 7 cut(s) 77, 1889, 3122, 3779, 4128, 4337, 4404
AclI AACGTT 1 cut(s) 2945
AcoI YGGCCR 3 cut(s) 3508, 4076, 4467
AcsI RAATTY 7 cut(s) 688, 1000, 2092, 3256, 3682, 3928, 4135
AcuI CTGAAG 5 cut(s) 314, 510, 626, 3274, 3894
AcyI GRCGYC 2 cut(s) 2477, 4280
AdeI CACNNNGTG 3 cut(s) 3104, 3565, 4887
AfeI AGCGCT 1 cut(s) 1871
AfiI CCNNNNNNNGG 8 cut(s) 1327, 1328, 3049, 3101, 3104, 3530, 3568, 4159
AflII CTTAAG 1 cut(s) 4526
AgeI ACCGGT 1 cut(s) 1490
AjuI GAANNNNNNNTTGG 4 cut(s) 537, 569, 4006, 4038
Alw21I GWGCWC 2 cut(s) 371, 1453
Alw44I GTGCAC 1 cut(s) 1449
AlwNI CAGNNNCTG 2 cut(s) 1333, 4433
Ama87I CYCGRG 3 cut(s) 1829, 3882, 4755
Aor51HI AGCGCT 1 cut(s) 1871
AoxI GGCC 9 cut(s) 89, 541, 1283, 1318, 3119, 3508, 4076, 4399, 4467
ApaLI GTGCAC 1 cut(s) 1449
ApoI RAATTY 7 cut(s) 688, 1000, 2092, 3256, 3682, 3928, 4135
AseI ATTAAT 2 cut(s) 753, 1950
AsiGI ACCGGT 1 cut(s) 1490
Asp700I GAANNNNTTC 1 cut(s) 1758
AspLEI GCGC 4 cut(s) 879, 1045, 1872, 2162
AspS9I GGNCC 6 cut(s) 541, 1319, 2396, 2927, 4033, 4400
AsuC2I CCSGG 1 cut(s) 1179
AsuII TTCGAA 4 cut(s) 158, 2878, 3314, 3428
AvaI CYCGRG 3 cut(s) 1829, 3882, 4755
AvaII GGWCC 3 cut(s) 2396, 2927, 4033
BaeGI GKGCMC 2 cut(s) 1453, 2410
BaeI ACNNNNGTAYC 2 cut(s) 1998, 2031
BalI TGGCCA 3 cut(s) 3510, 4078, 4469
BamHI GGATCC 3 cut(s) 27, 1393, 3439
BanI GGYRCC 2 cut(s) 2405, 3946
BanII GRGCYC 1 cut(s) 2779
BarI GAAGNNNNNNTAC 2 cut(s) 1540, 1572
BbsI GAAGAC 6 cut(s) 302, 1533, 3527, 4272, 4366, 4467
Bbv12I GWGCWC 2 cut(s) 371, 1453
BbvCI CCTCAGC 2 cut(s) 897, 3006
BccI CCATC 9 cut(s) 74, 423, 978, 1973, 2740, 3023, 3665, 3799, 4755
BceAI ACGGC 2 cut(s) 3501, 4101
BcgI CGANNNNNNTGC 4 cut(s) 1865, 1899, 3518, 3552
BciVI GTATCC 2 cut(s) 922, 2065
BclI TGATCA 4 cut(s) 226, 1078, 2557, 3658
BcnI CCSGG 1 cut(s) 1179
BfaI CTAG 8 cut(s) 47, 936, 1017, 1343, 1479, 2061, 2211, 2400
BfmI CTRYAG 7 cut(s) 659, 708, 1247, 2376, 2544, 3975, 4504
BfoI RGCGCY 1 cut(s) 1873
BfrI CTTAAG 1 cut(s) 4526
BfuAI ACCTGC 3 cut(s) 1617, 2959, 4511
BfuI GTATCC 2 cut(s) 922, 2065
BglI GCCNNNNNGGC 1 cut(s) 549
BlpI GCTNAGC 1 cut(s) 717
BmcAI AGTACT 1 cut(s) 4522
Bme18I GGWCC 3 cut(s) 2396, 2927, 4033
BmeT110I CYCGRG 3 cut(s) 1829, 3882, 4755
BmgT120I GGNCC 6 cut(s) 541, 1319, 2396, 2927, 4033, 4400
BmrI ACTGGG 2 cut(s) 2493, 4279
BmuI ACTGGG 2 cut(s) 2493, 4279
BoxI GACNNNNGTC 1 cut(s) 3646
BpiI GAAGAC 6 cut(s) 302, 1533, 3527, 4272, 4366, 4467
BplI GAGNNNNNCTC 2 cut(s) 1716, 1748
BpmI CTGGAG 4 cut(s) 959, 1077, 1465, 3282
Bpu10I CCTNAGC 2 cut(s) 897, 3006
Bpu1102I GCTNAGC 1 cut(s) 717
Bpu14I TTCGAA 4 cut(s) 158, 2878, 3314, 3428
BpuMI CCSGG 1 cut(s) 1179
BsaBI GATNNNNATC 1 cut(s) 4056
BsaHI GRCGYC 2 cut(s) 2477, 4280
BsaI GGTCTC 2 cut(s) 247, 4165
BsaJI CCNNGG 7 cut(s) 1200, 1681, 2010, 2771, 3368, 3483, 4208
BsaWI WCCGGW 1 cut(s) 1490
Bsc4I CCNNNNNNNGG 8 cut(s) 1327, 1328, 3049, 3101, 3104, 3530, 3568, 4159
Bse118I RCCGGY 1 cut(s) 1490
Bse3DI GCAATG 4 cut(s) 208, 1420, 3579, 4844
Bse8I GATNNNNATC 1 cut(s) 4056
BseDI CCNNGG 7 cut(s) 1200, 1681, 2010, 2771, 3368, 3483, 4208
BseJI GATNNNNATC 1 cut(s) 4056
BseLI CCNNNNNNNGG 8 cut(s) 1327, 1328, 3049, 3101, 3104, 3530, 3568, 4159
BseMI GCAATG 4 cut(s) 208, 1420, 3579, 4844
BseRI GAGGAG 5 cut(s) 885, 1517, 2237, 2994, 3780
BseSI GKGCMC 2 cut(s) 1453, 2410
BseYI CCCAGC 2 cut(s) 728, 2781
BsgI GTGCAG 5 cut(s) 821, 1595, 3542, 3587, 4424
BshFI GGCC 9 cut(s) 91, 543, 1285, 1320, 3121, 3510, 4078, 4401, 4469
BshNI GGYRCC 2 cut(s) 2405, 3946
BshTI ACCGGT 1 cut(s) 1490
BsiHKAI GWGCWC 2 cut(s) 371, 1453
BsiHKCI CYCGRG 3 cut(s) 1829, 3882, 4755
BsiSI CCGG 2 cut(s) 1178, 1491
BslFI GGGAC 5 cut(s) 435, 2312, 2820, 3871, 4803
BslI CCNNNNNNNGG 8 cut(s) 1327, 1328, 3049, 3101, 3104, 3530, 3568, 4159
BsmBI CGTCTC 2 cut(s) 2468, 2622
BsmFI GGGAC 5 cut(s) 435, 2312, 2820, 3871, 4803
BsmI GAATGC 5 cut(s) 552, 1228, 1701, 3310, 3354
BsnI GGCC 9 cut(s) 91, 543, 1285, 1320, 3121, 3510, 4078, 4401, 4469
Bso31I GGTCTC 2 cut(s) 247, 4165
BsoBI CYCGRG 3 cut(s) 1829, 3882, 4755
Bsp119I TTCGAA 4 cut(s) 158, 2878, 3314, 3428
Bsp1286I GDGCHC 4 cut(s) 371, 1453, 2410, 2779
Bsp1407I TGTACA 2 cut(s) 1962, 2565
Bsp1720I GCTNAGC 1 cut(s) 717
Bsp19I CCATGG 1 cut(s) 4208
BspACI CCGC 7 cut(s) 77, 1889, 3122, 3779, 4128, 4337, 4404
BspANI GGCC 9 cut(s) 91, 543, 1285, 1320, 3121, 3510, 4078, 4401, 4469
BspHI TCATGA 1 cut(s) 1750
BspMAI CTGCAG 4 cut(s) 712, 1251, 3979, 4508
BspMI ACCTGC 3 cut(s) 1617, 2959, 4511
BspQI GCTCTTC 1 cut(s) 3297
BspT104I TTCGAA 4 cut(s) 158, 2878, 3314, 3428
BspT107I GGYRCC 2 cut(s) 2405, 3946
BspTI CTTAAG 1 cut(s) 4526
BspTNI GGTCTC 2 cut(s) 247, 4165
BsrDI GCAATG 4 cut(s) 208, 1420, 3579, 4844
BsrFI RCCGGY 1 cut(s) 1490
BsrGI TGTACA 2 cut(s) 1962, 2565
BssAI RCCGGY 1 cut(s) 1490
BssECI CCNNGG 7 cut(s) 1200, 1681, 2010, 2771, 3368, 3483, 4208
BssNI GRCGYC 2 cut(s) 2477, 4280
BssT1I CCWWGG 3 cut(s) 1200, 2771, 4208
Bst6I CTCTTC 4 cut(s) 1350, 1627, 1988, 3297
BstACI GRCGYC 2 cut(s) 2477, 4280
BstAFI CTTAAG 1 cut(s) 4526
BstAPI GCANNNNNTGC 5 cut(s) 604, 3565, 3971, 4393, 4433
BstAUI TGTACA 2 cut(s) 1962, 2565
BstBI TTCGAA 4 cut(s) 158, 2878, 3314, 3428
BstDSI CCRYGG 2 cut(s) 3483, 4208
BstH2I RGCGCY 1 cut(s) 1873
BstHHI GCGC 4 cut(s) 879, 1045, 1872, 2162
BstNSI RCATGY 4 cut(s) 1651, 2921, 3094, 4494
BstPAI GACNNNNGTC 1 cut(s) 3646
BstSFI CTRYAG 7 cut(s) 659, 708, 1247, 2376, 2544, 3975, 4504
BstSLI GKGCMC 2 cut(s) 1453, 2410
BstV2I GAAGAC 6 cut(s) 302, 1533, 3527, 4272, 4366, 4467
BstX2I RGATCY 8 cut(s) 27, 206, 1193, 1345, 1393, 3439, 3607, 3757
BstXI CCANNNNNNTGG 1 cut(s) 3506
BstYI RGATCY 8 cut(s) 27, 206, 1193, 1345, 1393, 3439, 3607, 3757
BsuI GTATCC 2 cut(s) 922, 2065
BsuRI GGCC 9 cut(s) 91, 543, 1285, 1320, 3121, 3510, 4078, 4401, 4469
BtgI CCRYGG 2 cut(s) 3483, 4208
BveI ACCTGC 3 cut(s) 1617, 2959, 4511
CaiI CAGNNNCTG 2 cut(s) 1333, 4433
CciI TCATGA 1 cut(s) 1750
CfoI GCGC 4 cut(s) 879, 1045, 1872, 2162
Cfr10I RCCGGY 1 cut(s) 1490
Cfr13I GGNCC 6 cut(s) 541, 1319, 2396, 2927, 4033, 4400
CseI GACGC 1 cut(s) 4269
CsiI ACCWGGT 1 cut(s) 3561
CspAI ACCGGT 1 cut(s) 1490
CspCI CAANNNNNGTGG 2 cut(s) 4590, 4625
DraI TTTAAA 1 cut(s) 1185
DraIII CACNNNGTG 3 cut(s) 3104, 3565, 4887
DrdI GACNNNNNNGTC 1 cut(s) 4698
DseDI GACNNNNNNGTC 1 cut(s) 4698
EaeI YGGCCR 3 cut(s) 3508, 4076, 4467
Eam1104I CTCTTC 4 cut(s) 1350, 1627, 1988, 3297
EarI CTCTTC 4 cut(s) 1350, 1627, 1988, 3297
Eco130I CCWWGG 3 cut(s) 1200, 2771, 4208
Eco24I GRGCYC 1 cut(s) 2779
Eco31I GGTCTC 2 cut(s) 247, 4165
Eco32I GATATC 1 cut(s) 4165
Eco47I GGWCC 3 cut(s) 2396, 2927, 4033
Eco47III AGCGCT 1 cut(s) 1871
Eco57I CTGAAG 5 cut(s) 314, 510, 626, 3274, 3894
Eco88I CYCGRG 3 cut(s) 1829, 3882, 4755
EcoO109I RGGNCCY 1 cut(s) 2927
EcoRI GAATTC 3 cut(s) 688, 3682, 4135
EcoRV GATATC 1 cut(s) 4165
EcoT14I CCWWGG 3 cut(s) 1200, 2771, 4208
EcoT22I ATGCAT 5 cut(s) 439, 2838, 2923, 4492, 4807
EcoT38I GRGCYC 1 cut(s) 2779
ErhI CCWWGG 3 cut(s) 1200, 2771, 4208
Esp3I CGTCTC 2 cut(s) 2468, 2622
FaqI GGGAC 5 cut(s) 435, 2312, 2820, 3871, 4803
FauI CCCGC 2 cut(s) 4121, 4411
FauNDI CATATG 3 cut(s) 2100, 2311, 2347
FbaI TGATCA 4 cut(s) 226, 1078, 2557, 3658
FblI GTMKAC 1 cut(s) 1495
FriOI GRGCYC 1 cut(s) 2779
FspBI CTAG 8 cut(s) 47, 936, 1017, 1343, 1479, 2061, 2211, 2400
FspI TGCGCA 1 cut(s) 1044
GlaI GCGC 4 cut(s) 878, 1044, 1871, 2161
GsaI CCCAGC 2 cut(s) 732, 2785
GsuI CTGGAG 4 cut(s) 959, 1077, 1465, 3282
HaeII RGCGCY 1 cut(s) 1873
HaeIII GGCC 9 cut(s) 91, 543, 1285, 1320, 3121, 3510, 4078, 4401, 4469
HapII CCGG 2 cut(s) 1178, 1491
HgaI GACGC 1 cut(s) 4269
HhaI GCGC 4 cut(s) 879, 1045, 1872, 2162
Hin1I GRCGYC 2 cut(s) 2477, 4280
Hin6I GCGC 4 cut(s) 877, 1043, 1870, 2160
HinP1I GCGC 4 cut(s) 877, 1043, 1870, 2160
HincII GTYRAC 5 cut(s) 769, 1008, 2461, 3022, 3035
HindII GTYRAC 5 cut(s) 769, 1008, 2461, 3022, 3035
HindIII AAGCTT 4 cut(s) 492, 2183, 3771, 3876
HpaI GTTAAC 1 cut(s) 769
HpaII CCGG 2 cut(s) 1178, 1491
Hpy99I CGWCG 1 cut(s) 3529
HpyCH4IV ACGT 2 cut(s) 2477, 2945
HpySE526I ACGT 2 cut(s) 2477, 2945
Hsp92I GRCGYC 2 cut(s) 2477, 4280
HspAI GCGC 4 cut(s) 877, 1043, 1870, 2160
Ksp22I TGATCA 4 cut(s) 226, 1078, 2557, 3658
KspAI GTTAAC 1 cut(s) 769
LguI GCTCTTC 1 cut(s) 3297
MabI ACCWGGT 1 cut(s) 3561
MaeI CTAG 8 cut(s) 47, 936, 1017, 1343, 1479, 2061, 2211, 2400
MaeII ACGT 2 cut(s) 2477, 2945
MfeI CAATTG 1 cut(s) 2042
MflI RGATCY 8 cut(s) 27, 206, 1193, 1345, 1393, 3439, 3607, 3757
MhlI GDGCHC 4 cut(s) 371, 1453, 2410, 2779
MlsI TGGCCA 3 cut(s) 3510, 4078, 4469
MluNI TGGCCA 3 cut(s) 3510, 4078, 4469
MlyI GAGTC 5 cut(s) 241, 964, 2716, 3844, 4018
MmeI TCCRAC 5 cut(s) 196, 496, 1773, 4641, 4689
Mox20I TGGCCA 3 cut(s) 3510, 4078, 4469
Mph1103I ATGCAT 5 cut(s) 439, 2838, 2923, 4492, 4807
MroXI GAANNNNTTC 1 cut(s) 1758
MscI TGGCCA 3 cut(s) 3510, 4078, 4469
MslI CAYNNNNRTG 3 cut(s) 201, 1740, 3459
Msp20I TGGCCA 3 cut(s) 3510, 4078, 4469
MspA1I CMGCKG 1 cut(s) 2420
MspCI CTTAAG 1 cut(s) 4526
MspI CCGG 2 cut(s) 1178, 1491
MunI CAATTG 1 cut(s) 2042
Mva1269I GAATGC 5 cut(s) 552, 1228, 1701, 3310, 3354
NciI CCSGG 1 cut(s) 1179
NcoI CCATGG 1 cut(s) 4208
NdeI CATATG 3 cut(s) 2100, 2311, 2347
NmuCI GTSAC 6 cut(s) 2119, 2524, 3461, 4199, 4453, 4831
NsbI TGCGCA 1 cut(s) 1044
NsiI ATGCAT 5 cut(s) 439, 2838, 2923, 4492, 4807
NspI RCATGY 4 cut(s) 1651, 2921, 3094, 4494
NspV TTCGAA 4 cut(s) 158, 2878, 3314, 3428
PaeI GCATGC 2 cut(s) 3094, 4494
PaeR7I CTCGAG 1 cut(s) 1829
PagI TCATGA 1 cut(s) 1750
PciSI GCTCTTC 1 cut(s) 3297
PctI GAATGC 5 cut(s) 552, 1228, 1701, 3310, 3354
PdmI GAANNNNTTC 1 cut(s) 1758
PflFI GACNNNGTC 1 cut(s) 4815
PflMI CCANNNNNTGG 2 cut(s) 3104, 4159
PinAI ACCGGT 1 cut(s) 1490
PleI GAGTC 5 cut(s) 241, 963, 2715, 3843, 4017
PpsI GAGTC 5 cut(s) 241, 963, 2715, 3843, 4017
PpuMI RGGWCCY 1 cut(s) 2927
PshAI GACNNNNGTC 1 cut(s) 3646
PshBI ATTAAT 2 cut(s) 753, 1950
Psp1406I AACGTT 1 cut(s) 2945
Psp5II RGGWCCY 1 cut(s) 2927
PspFI CCCAGC 2 cut(s) 728, 2781
PspPI GGNCC 6 cut(s) 541, 1319, 2396, 2927, 4033, 4400
PspPPI RGGWCCY 1 cut(s) 2927
PspXI VCTCGAGB 1 cut(s) 1829
PstI CTGCAG 4 cut(s) 712, 1251, 3979, 4508
PstNI CAGNNNCTG 2 cut(s) 1333, 4433
PsuI RGATCY 8 cut(s) 27, 206, 1193, 1345, 1393, 3439, 3607, 3757
PsyI GACNNNGTC 1 cut(s) 4815
PvuII CAGCTG 1 cut(s) 2420
RseI CAYNNNNRTG 3 cut(s) 201, 1740, 3459
SapI GCTCTTC 1 cut(s) 3297
Sau96I GGNCC 6 cut(s) 541, 1319, 2396, 2927, 4033, 4400
ScaI AGTACT 1 cut(s) 4522
SchI GAGTC 5 cut(s) 241, 964, 2716, 3844, 4018
SduI GDGCHC 4 cut(s) 371, 1453, 2410, 2779
SexAI ACCWGGT 1 cut(s) 3561
SfcI CTRYAG 7 cut(s) 659, 708, 1247, 2376, 2544, 3975, 4504
Sfr274I CTCGAG 1 cut(s) 1829
SfuI TTCGAA 4 cut(s) 158, 2878, 3314, 3428
SinI GGWCC 3 cut(s) 2396, 2927, 4033
SlaI CTCGAG 1 cut(s) 1829
SmiMI CAYNNNNRTG 3 cut(s) 201, 1740, 3459
SphI GCATGC 2 cut(s) 3094, 4494
SsiI CCGC 7 cut(s) 77, 1889, 3122, 3779, 4128, 4337, 4404
SspI AATATT 2 cut(s) 271, 1948
SspMI CTAG 8 cut(s) 47, 936, 1017, 1343, 1479, 2061, 2211, 2400
StyI CCWWGG 3 cut(s) 1200, 2771, 4208
TaiI ACGT 2 cut(s) 2480, 2948
TaqII GACCGA 2 cut(s) 1844, 3605
TatI WGTACW 5 cut(s) 1027, 1085, 1962, 2565, 4520
TauI GCSGC 1 cut(s) 3124
TseFI GTSAC 6 cut(s) 2119, 2524, 3461, 4199, 4453, 4831
Tsp45I GTSAC 6 cut(s) 2119, 2524, 3461, 4199, 4453, 4831
TspGWI ACGGA 6 cut(s) 2316, 3513, 3640, 4468, 4637, 4711
Tth111I GACNNNGTC 1 cut(s) 4815
Van91I CCANNNNNTGG 2 cut(s) 3104, 4159
Vha464I CTTAAG 1 cut(s) 4526
VneI GTGCAC 1 cut(s) 1449
VpaK11BI GGWCC 3 cut(s) 2396, 2927, 4033
VspI ATTAAT 2 cut(s) 753, 1950
XapI RAATTY 7 cut(s) 688, 1000, 2092, 3256, 3682, 3928, 4135
XbaI TCTAGA 1 cut(s) 1342
XceI RCATGY 4 cut(s) 1651, 2921, 3094, 4494
XcmI CCANNNNNNNNNTGG 2 cut(s) 2417, 2778
XhoI CTCGAG 1 cut(s) 1829
XmiI GTMKAC 1 cut(s) 1495
XmnI GAANNNNTTC 1 cut(s) 1758
XspI CTAG 8 cut(s) 47, 936, 1017, 1343, 1479, 2061, 2211, 2400
ZraI GACGTC 1 cut(s) 2478
ZrmI AGTACT 1 cut(s) 4522
Zsp2I ATGCAT 5 cut(s) 439, 2838, 2923, 4492, 4807
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.