Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006572.1

Orthogroup ID

OG0011386

Physical Location & Seq

Genomic Coordinates Reverse (-)

14973 .. 16304

Gene Structure 1332 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006572.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 618 bp

atgttgctacagtcaacttttccgattcgggagaaaaaaatccatgaaagatcgtttattactctggcaactagtctggtccagaactgttgcagtgagccgagtttcagtatgcagacatcaaagatcgactttaactctgtcccttttttcccccaaaggagatttcagccaagaaagcagcaatggggattagcctttgccttggacacaggtggggttcctgataatggtggccaagagagcgtcaatgacgacagcatcaatgatctcaatcgcactcgtttaggtcggatagtgactgcagctggaagacagctattagagaagctgaacttagctagaaaaaactttcccatgaagatatttctacttcttttgggtttctacacggcaaatgcattggccacgatccttgggcagacaggagattgggatgttttggttgcaggaattgtggttgctgctattgagggtattggcatgctcatgtatagaaagcccacttccccttctttatcaagtgggaagctcaagtcttttgtcatgctgatgaattactggaaagccggtgtgtgcttaggcctctttgtggatgcttttaaattgggtagttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0008150 GO:0009314 GO:0009416 GO:0009507 GO:0009536 GO:0009628 GO:0010196 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0050896 GO:1990066

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF565

Protein Analysis

205

Amino Acids

22.7

Weight (kDa)

9.63

Isoelectric Point (pI)

33.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011386)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G65420
fragaria_vesca	FvH4_6g00150 FvH4_6g00150 FvH4_6g00150
malus_domestica	MD04G1247900.v1.1 MD12G1262600.v1.1
prunus_persica	Prupe.6G364400_v2.0.a1 Prupe.6G364400_v2.0.a1 Prupe.6G364400_v2.0.a1
pyrus_communis	pycom04g21860
rosa_chinensis	RchiOBHm_Chr3g0447501
rosa_laevigata	RLG00000025992
rosa_multiflora	Rmu_sc0006572.1_g000003
rosa_roxburghii	Rroxscaffold_6G00425720
rosa_rugosa	Rorug02G0602400
rosa_samantha	Rh3AG002600 Rh3BG002100 Rh3CG002400 Rh3DG002500
rosa_wichuraiana	Rw3G000150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	406
AcoI	YGGCCR	2 cut(s)	235, 405
AfiI	CCNNNNNNNGG	2 cut(s)	230, 592
AhlI	ACTAGT	1 cut(s)	71
AjuI	GAANNNNNNNTTGG	2 cut(s)	150, 182
AluBI	AGCT	5 cut(s)	308, 319, 331, 341, 532
AluI	AGCT	5 cut(s)	308, 319, 331, 341, 532
AlwI	GGATC	1 cut(s)	406
AoxI	GGCC	3 cut(s)	235, 405, 583
ApeKI	GCWGC	3 cut(s)	181, 305, 464
AspS9I	GGNCC	1 cut(s)	79
AvaII	GGWCC	1 cut(s)	79
BalI	TGGCCA	2 cut(s)	237, 407
BbsI	GAAGAC	1 cut(s)	319
BbvI	GCAGC	3 cut(s)	193, 317, 451
BceAI	ACGGC	1 cut(s)	408
BcuI	ACTAGT	1 cut(s)	71
BfaI	CTAG	2 cut(s)	72, 342
BfmI	CTRYAG	2 cut(s)	8, 303
BisI	GCNGC	3 cut(s)	182, 306, 465
BlsI	GCNGC	3 cut(s)	183, 307, 466
Bme18I	GGWCC	1 cut(s)	79
BmgT120I	GGNCC	1 cut(s)	79
BmiI	GGNNCC	1 cut(s)	222
BmsI	GCATC	2 cut(s)	270, 586
BpiI	GAAGAC	1 cut(s)	319
Bpu10I	CCTNAGC	1 cut(s)	580
BpuEI	CTTGAG	1 cut(s)	518
BsaBI	GATNNNNATC	1 cut(s)	273
BsaJI	CCNNGG	2 cut(s)	204, 415
Bsc4I	CCNNNNNNNGG	2 cut(s)	230, 592
Bse118I	RCCGGY	1 cut(s)	569
Bse1I	ACTGG	1 cut(s)	566
Bse3DI	GCAATG	1 cut(s)	191
Bse8I	GATNNNNATC	1 cut(s)	273
BseDI	CCNNGG	2 cut(s)	204, 415
BseGI	GGATG	2 cut(s)	442, 601
BseJI	GATNNNNATC	1 cut(s)	273
BseLI	CCNNNNNNNGG	2 cut(s)	230, 592
BseMI	GCAATG	1 cut(s)	191
BseNI	ACTGG	1 cut(s)	566
BseXI	GCAGC	3 cut(s)	193, 317, 451
BshFI	GGCC	3 cut(s)	237, 407, 585
BsiSI	CCGG	1 cut(s)	570
BslFI	GGGAC	1 cut(s)	128
BslI	CCNNNNNNNGG	2 cut(s)	230, 592
BsmFI	GGGAC	1 cut(s)	128
BsnI	GGCC	3 cut(s)	237, 407, 585
Bsp143I	GATC	4 cut(s)	50, 126, 268, 411
BspANI	GGCC	3 cut(s)	237, 407, 585
BspLI	GGNNCC	1 cut(s)	222
BspMAI	CTGCAG	1 cut(s)	307
BspPI	GGATC	1 cut(s)	406
BsrDI	GCAATG	1 cut(s)	191
BsrFI	RCCGGY	1 cut(s)	569
BsrI	ACTGG	1 cut(s)	566
BssAI	RCCGGY	1 cut(s)	569
BssECI	CCNNGG	2 cut(s)	204, 415
BssMI	GATC	4 cut(s)	50, 126, 268, 411
BssT1I	CCWWGG	2 cut(s)	204, 415
Bst4CI	ACNGT	2 cut(s)	12, 89
BstC8I	GCNNGC	1 cut(s)	485
BstDEI	CTNAG	2 cut(s)	337, 580
BstF5I	GGATG	2 cut(s)	442, 601
BstKTI	GATC	4 cut(s)	53, 129, 271, 414
BstMBI	GATC	4 cut(s)	50, 126, 268, 411
BstMWI	GCNNNNNNNGC	2 cut(s)	178, 243
BstNSI	RCATGY	1 cut(s)	487
BstSFI	CTRYAG	2 cut(s)	8, 303
BstV1I	GCAGC	3 cut(s)	193, 317, 451
BstV2I	GAAGAC	1 cut(s)	319
BsuRI	GGCC	3 cut(s)	237, 407, 585
BtsCI	GGATG	2 cut(s)	442, 601
BtsI	GCAGTG	1 cut(s)	100
BtsIMutI	CAGTG	1 cut(s)	100
Cac8I	GCNNGC	1 cut(s)	485
Cfr10I	RCCGGY	1 cut(s)	569
Cfr13I	GGNCC	1 cut(s)	79
CseI	GACGC	1 cut(s)	235
CspCI	CAANNNNNGTGG	2 cut(s)	397, 432
CviAII	CATG	5 cut(s)	44, 358, 484, 490, 547
DdeI	CTNAG	2 cut(s)	337, 580
DpnI	GATC	4 cut(s)	52, 128, 270, 413
DpnII	GATC	4 cut(s)	50, 126, 268, 411
DraI	TTTAAA	1 cut(s)	604
EaeI	YGGCCR	2 cut(s)	235, 405
Eco130I	CCWWGG	2 cut(s)	204, 415
Eco147I	AGGCCT	1 cut(s)	585
Eco47I	GGWCC	1 cut(s)	79
EcoT14I	CCWWGG	2 cut(s)	204, 415
EcoT22I	ATGCAT	1 cut(s)	403
ErhI	CCWWGG	2 cut(s)	204, 415
FaeI	CATG	5 cut(s)	47, 361, 487, 493, 550
FaiI	YATR	7 cut(s)	45, 113, 359, 485, 491, 495, 548
FalI	AAGNNNNNCTT	4 cut(s)	116, 148, 320, 352
FaqI	GGGAC	1 cut(s)	128
FatI	CATG	5 cut(s)	43, 357, 483, 489, 546
Fnu4HI	GCNGC	3 cut(s)	182, 306, 465
FokI	GGATG	2 cut(s)	449, 608
Fsp4HI	GCNGC	3 cut(s)	182, 306, 465
FspBI	CTAG	2 cut(s)	72, 342
GluI	GCNGC	3 cut(s)	182, 306, 465
HaeIII	GGCC	3 cut(s)	237, 407, 585
HapII	CCGG	1 cut(s)	570
HgaI	GACGC	1 cut(s)	235
Hin1II	CATG	5 cut(s)	47, 361, 487, 493, 550
HincII	GTYRAC	1 cut(s)	15
HindII	GTYRAC	1 cut(s)	15
HinfI	GANTC	1 cut(s)	25
HpaII	CCGG	1 cut(s)	570
Hpy166II	GTNNAC	1 cut(s)	15
Hpy188I	TCNGA	2 cut(s)	24, 294
Hpy188III	TCNNGA	3 cut(s)	29, 82, 224
Hpy8I	GTNNAC	1 cut(s)	15
HpyAV	CCTTC	1 cut(s)	522
HpyCH4III	ACNGT	2 cut(s)	12, 89
HpyCH4V	TGCA	5 cut(s)	93, 115, 305, 401, 449
HpyF10VI	GCNNNNNNNGC	2 cut(s)	178, 243
HpyF3I	CTNAG	2 cut(s)	337, 580
Hsp92II	CATG	5 cut(s)	47, 361, 487, 493, 550
Kzo9I	GATC	4 cut(s)	50, 126, 268, 411
Lsp1109I	GCAGC	3 cut(s)	193, 317, 451
LweI	GCATC	2 cut(s)	270, 586
MaeI	CTAG	2 cut(s)	72, 342
MaeIII	GTNAC	1 cut(s)	298
MalI	GATC	4 cut(s)	52, 128, 270, 413
MboI	GATC	4 cut(s)	50, 126, 268, 411
MboII	GAAGA	2 cut(s)	324, 373
MlsI	TGGCCA	2 cut(s)	237, 407
MluCI	AATT	3 cut(s)	453, 556, 605
MluNI	TGGCCA	2 cut(s)	237, 407
MmeI	TCCRAC	1 cut(s)	272
MnlI	CCTC	2 cut(s)	466, 596
Mox20I	TGGCCA	2 cut(s)	237, 407
Mph1103I	ATGCAT	1 cut(s)	403
MscI	TGGCCA	2 cut(s)	237, 407
MseI	TTAA	2 cut(s)	135, 603
MslI	CAYNNNNRTG	2 cut(s)	488, 551
Msp20I	TGGCCA	2 cut(s)	237, 407
MspA1I	CMGCKG	1 cut(s)	308
MspI	CCGG	1 cut(s)	570
MwoI	GCNNNNNNNGC	2 cut(s)	178, 243
NdeII	GATC	4 cut(s)	50, 126, 268, 411
NlaIII	CATG	5 cut(s)	47, 361, 487, 493, 550
NlaIV	GGNNCC	1 cut(s)	222
NmeAIII	GCCGAG	1 cut(s)	126
NmuCI	GTSAC	1 cut(s)	298
NsiI	ATGCAT	1 cut(s)	403
NspI	RCATGY	1 cut(s)	487
PaeI	GCATGC	1 cut(s)	487
PceI	AGGCCT	1 cut(s)	585
PfeI	GAWTC	1 cut(s)	25
PkrI	GCNGC	3 cut(s)	183, 307, 466
PspN4I	GGNNCC	1 cut(s)	222
PspPI	GGNCC	1 cut(s)	79
PstI	CTGCAG	1 cut(s)	307
PvuII	CAGCTG	1 cut(s)	308
RseI	CAYNNNNRTG	2 cut(s)	488, 551
SaqAI	TTAA	2 cut(s)	135, 603
SatI	GCNGC	3 cut(s)	182, 306, 465
Sau3AI	GATC	4 cut(s)	50, 126, 268, 411
Sau96I	GGNCC	1 cut(s)	79
SetI	ASST	7 cut(s)	217, 292, 310, 321, 333, 343, 534
SfaNI	GCATC	2 cut(s)	270, 586
SfcI	CTRYAG	2 cut(s)	8, 303
SinI	GGWCC	1 cut(s)	79
SmiMI	CAYNNNNRTG	2 cut(s)	488, 551
SmlI	CTYRAG	1 cut(s)	533
SmoI	CTYRAG	1 cut(s)	533
SpeI	ACTAGT	1 cut(s)	71
SphI	GCATGC	1 cut(s)	487
Sse9I	AATT	3 cut(s)	453, 556, 605
SseBI	AGGCCT	1 cut(s)	585
SspMI	CTAG	2 cut(s)	72, 342
StuI	AGGCCT	1 cut(s)	585
StyI	CCWWGG	2 cut(s)	204, 415
TaaI	ACNGT	2 cut(s)	12, 89
TaqI	TCGA	1 cut(s)	129
TasI	AATT	3 cut(s)	453, 556, 605
TfiI	GAWTC	1 cut(s)	25
Tru1I	TTAA	2 cut(s)	135, 603
Tru9I	TTAA	2 cut(s)	135, 603
TscAI	CASTG	1 cut(s)	100
TseFI	GTSAC	1 cut(s)	298
TseI	GCWGC	3 cut(s)	181, 305, 464
Tsp45I	GTSAC	1 cut(s)	298
TspDTI	ATGAA	3 cut(s)	60, 374, 569
TspRI	CASTG	1 cut(s)	100
VpaK11BI	GGWCC	1 cut(s)	79
XceI	RCATGY	1 cut(s)	487
XspI	CTAG	2 cut(s)	72, 342
Zsp2I	ATGCAT	1 cut(s)	403

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.