Rmu_sc0006572.1_g000003

ycf20-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006572.1
OG0011386
Physical Location & Seq
Reverse (-)
14973 .. 16304
1332 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 618 bp
atgttgctacagtcaacttttccgattcgggagaaaaaaatccatgaaagatcgtttattactctggcaactagtctggtccagaactgttgcagtgagccgagtttcagtatgcagacatcaaagatcgactttaactctgtcccttttttcccccaaaggagatttcagccaagaaagcagcaatggggattagcctttgccttggacacaggtggggttcctgataatggtggccaagagagcgtcaatgacgacagcatcaatgatctcaatcgcactcgtttaggtcggatagtgactgcagctggaagacagctattagagaagctgaacttagctagaaaaaactttcccatgaagatatttctacttcttttgggtttctacacggcaaatgcattggccacgatccttgggcagacaggagattgggatgttttggttgcaggaattgtggttgctgctattgagggtattggcatgctcatgtatagaaagcccacttccccttctttatcaagtgggaagctcaagtcttttgtcatgctgatgaattactggaaagccggtgtgtgcttaggcctctttgtggatgcttttaaattgggtagttag

Protein Analysis

205

Amino Acids

22.7

Weight (kDa)

9.63

Isoelectric Point (pI)

33.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF565 PF04483 141 - 205 3.1e-22 Protein of unknown function (DUF565)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011386)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G65420
fragaria_vesca FvH4_6g00150 FvH4_6g00150 FvH4_6g00150
malus_domestica MD04G1247900.v1.1 MD12G1262600.v1.1
prunus_persica Prupe.6G364400_v2.0.a1 Prupe.6G364400_v2.0.a1 Prupe.6G364400_v2.0.a1
pyrus_communis pycom04g21860
rosa_chinensis RchiOBHm_Chr3g0447501
rosa_laevigata RLG00000025992
rosa_multiflora Rmu_sc0006572.1_g000003
rosa_roxburghii Rroxscaffold_6G00425720
rosa_rugosa Rorug02G0602400
rosa_samantha Rh3AG002600 Rh3BG002100 Rh3CG002400 Rh3DG002500
rosa_wichuraiana Rw3G000150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 406
AcoI YGGCCR 2 cut(s) 235, 405
AfiI CCNNNNNNNGG 2 cut(s) 230, 592
AhlI ACTAGT 1 cut(s) 71
AjuI GAANNNNNNNTTGG 2 cut(s) 150, 182
AluBI AGCT 5 cut(s) 308, 319, 331, 341, 532
AluI AGCT 5 cut(s) 308, 319, 331, 341, 532
AlwI GGATC 1 cut(s) 406
AoxI GGCC 3 cut(s) 235, 405, 583
ApeKI GCWGC 3 cut(s) 181, 305, 464
AspS9I GGNCC 1 cut(s) 79
AvaII GGWCC 1 cut(s) 79
BalI TGGCCA 2 cut(s) 237, 407
BbsI GAAGAC 1 cut(s) 319
BbvI GCAGC 3 cut(s) 193, 317, 451
BceAI ACGGC 1 cut(s) 408
BcuI ACTAGT 1 cut(s) 71
BfaI CTAG 2 cut(s) 72, 342
BfmI CTRYAG 2 cut(s) 8, 303
BisI GCNGC 3 cut(s) 182, 306, 465
BlsI GCNGC 3 cut(s) 183, 307, 466
Bme18I GGWCC 1 cut(s) 79
BmgT120I GGNCC 1 cut(s) 79
BmiI GGNNCC 1 cut(s) 222
BmsI GCATC 2 cut(s) 270, 586
BpiI GAAGAC 1 cut(s) 319
Bpu10I CCTNAGC 1 cut(s) 580
BpuEI CTTGAG 1 cut(s) 518
BsaBI GATNNNNATC 1 cut(s) 273
BsaJI CCNNGG 2 cut(s) 204, 415
Bsc4I CCNNNNNNNGG 2 cut(s) 230, 592
Bse118I RCCGGY 1 cut(s) 569
Bse1I ACTGG 1 cut(s) 566
Bse3DI GCAATG 1 cut(s) 191
Bse8I GATNNNNATC 1 cut(s) 273
BseDI CCNNGG 2 cut(s) 204, 415
BseGI GGATG 2 cut(s) 442, 601
BseJI GATNNNNATC 1 cut(s) 273
BseLI CCNNNNNNNGG 2 cut(s) 230, 592
BseMI GCAATG 1 cut(s) 191
BseNI ACTGG 1 cut(s) 566
BseXI GCAGC 3 cut(s) 193, 317, 451
BshFI GGCC 3 cut(s) 237, 407, 585
BsiSI CCGG 1 cut(s) 570
BslFI GGGAC 1 cut(s) 128
BslI CCNNNNNNNGG 2 cut(s) 230, 592
BsmFI GGGAC 1 cut(s) 128
BsnI GGCC 3 cut(s) 237, 407, 585
Bsp143I GATC 4 cut(s) 50, 126, 268, 411
BspANI GGCC 3 cut(s) 237, 407, 585
BspLI GGNNCC 1 cut(s) 222
BspMAI CTGCAG 1 cut(s) 307
BspPI GGATC 1 cut(s) 406
BsrDI GCAATG 1 cut(s) 191
BsrFI RCCGGY 1 cut(s) 569
BsrI ACTGG 1 cut(s) 566
BssAI RCCGGY 1 cut(s) 569
BssECI CCNNGG 2 cut(s) 204, 415
BssMI GATC 4 cut(s) 50, 126, 268, 411
BssT1I CCWWGG 2 cut(s) 204, 415
Bst4CI ACNGT 2 cut(s) 12, 89
BstC8I GCNNGC 1 cut(s) 485
BstDEI CTNAG 2 cut(s) 337, 580
BstF5I GGATG 2 cut(s) 442, 601
BstKTI GATC 4 cut(s) 53, 129, 271, 414
BstMBI GATC 4 cut(s) 50, 126, 268, 411
BstMWI GCNNNNNNNGC 2 cut(s) 178, 243
BstNSI RCATGY 1 cut(s) 487
BstSFI CTRYAG 2 cut(s) 8, 303
BstV1I GCAGC 3 cut(s) 193, 317, 451
BstV2I GAAGAC 1 cut(s) 319
BsuRI GGCC 3 cut(s) 237, 407, 585
BtsCI GGATG 2 cut(s) 442, 601
BtsI GCAGTG 1 cut(s) 100
BtsIMutI CAGTG 1 cut(s) 100
Cac8I GCNNGC 1 cut(s) 485
Cfr10I RCCGGY 1 cut(s) 569
Cfr13I GGNCC 1 cut(s) 79
CseI GACGC 1 cut(s) 235
CspCI CAANNNNNGTGG 2 cut(s) 397, 432
CviAII CATG 5 cut(s) 44, 358, 484, 490, 547
DdeI CTNAG 2 cut(s) 337, 580
DpnI GATC 4 cut(s) 52, 128, 270, 413
DpnII GATC 4 cut(s) 50, 126, 268, 411
DraI TTTAAA 1 cut(s) 604
EaeI YGGCCR 2 cut(s) 235, 405
Eco130I CCWWGG 2 cut(s) 204, 415
Eco147I AGGCCT 1 cut(s) 585
Eco47I GGWCC 1 cut(s) 79
EcoT14I CCWWGG 2 cut(s) 204, 415
EcoT22I ATGCAT 1 cut(s) 403
ErhI CCWWGG 2 cut(s) 204, 415
FaeI CATG 5 cut(s) 47, 361, 487, 493, 550
FaiI YATR 7 cut(s) 45, 113, 359, 485, 491, 495, 548
FalI AAGNNNNNCTT 4 cut(s) 116, 148, 320, 352
FaqI GGGAC 1 cut(s) 128
FatI CATG 5 cut(s) 43, 357, 483, 489, 546
Fnu4HI GCNGC 3 cut(s) 182, 306, 465
FokI GGATG 2 cut(s) 449, 608
Fsp4HI GCNGC 3 cut(s) 182, 306, 465
FspBI CTAG 2 cut(s) 72, 342
GluI GCNGC 3 cut(s) 182, 306, 465
HaeIII GGCC 3 cut(s) 237, 407, 585
HapII CCGG 1 cut(s) 570
HgaI GACGC 1 cut(s) 235
Hin1II CATG 5 cut(s) 47, 361, 487, 493, 550
HincII GTYRAC 1 cut(s) 15
HindII GTYRAC 1 cut(s) 15
HinfI GANTC 1 cut(s) 25
HpaII CCGG 1 cut(s) 570
Hpy166II GTNNAC 1 cut(s) 15
Hpy188I TCNGA 2 cut(s) 24, 294
Hpy188III TCNNGA 3 cut(s) 29, 82, 224
Hpy8I GTNNAC 1 cut(s) 15
HpyAV CCTTC 1 cut(s) 522
HpyCH4III ACNGT 2 cut(s) 12, 89
HpyCH4V TGCA 5 cut(s) 93, 115, 305, 401, 449
HpyF10VI GCNNNNNNNGC 2 cut(s) 178, 243
HpyF3I CTNAG 2 cut(s) 337, 580
Hsp92II CATG 5 cut(s) 47, 361, 487, 493, 550
Kzo9I GATC 4 cut(s) 50, 126, 268, 411
Lsp1109I GCAGC 3 cut(s) 193, 317, 451
LweI GCATC 2 cut(s) 270, 586
MaeI CTAG 2 cut(s) 72, 342
MaeIII GTNAC 1 cut(s) 298
MalI GATC 4 cut(s) 52, 128, 270, 413
MboI GATC 4 cut(s) 50, 126, 268, 411
MboII GAAGA 2 cut(s) 324, 373
MlsI TGGCCA 2 cut(s) 237, 407
MluCI AATT 3 cut(s) 453, 556, 605
MluNI TGGCCA 2 cut(s) 237, 407
MmeI TCCRAC 1 cut(s) 272
MnlI CCTC 2 cut(s) 466, 596
Mox20I TGGCCA 2 cut(s) 237, 407
Mph1103I ATGCAT 1 cut(s) 403
MscI TGGCCA 2 cut(s) 237, 407
MseI TTAA 2 cut(s) 135, 603
MslI CAYNNNNRTG 2 cut(s) 488, 551
Msp20I TGGCCA 2 cut(s) 237, 407
MspA1I CMGCKG 1 cut(s) 308
MspI CCGG 1 cut(s) 570
MwoI GCNNNNNNNGC 2 cut(s) 178, 243
NdeII GATC 4 cut(s) 50, 126, 268, 411
NlaIII CATG 5 cut(s) 47, 361, 487, 493, 550
NlaIV GGNNCC 1 cut(s) 222
NmeAIII GCCGAG 1 cut(s) 126
NmuCI GTSAC 1 cut(s) 298
NsiI ATGCAT 1 cut(s) 403
NspI RCATGY 1 cut(s) 487
PaeI GCATGC 1 cut(s) 487
PceI AGGCCT 1 cut(s) 585
PfeI GAWTC 1 cut(s) 25
PkrI GCNGC 3 cut(s) 183, 307, 466
PspN4I GGNNCC 1 cut(s) 222
PspPI GGNCC 1 cut(s) 79
PstI CTGCAG 1 cut(s) 307
PvuII CAGCTG 1 cut(s) 308
RseI CAYNNNNRTG 2 cut(s) 488, 551
SaqAI TTAA 2 cut(s) 135, 603
SatI GCNGC 3 cut(s) 182, 306, 465
Sau3AI GATC 4 cut(s) 50, 126, 268, 411
Sau96I GGNCC 1 cut(s) 79
SetI ASST 7 cut(s) 217, 292, 310, 321, 333, 343, 534
SfaNI GCATC 2 cut(s) 270, 586
SfcI CTRYAG 2 cut(s) 8, 303
SinI GGWCC 1 cut(s) 79
SmiMI CAYNNNNRTG 2 cut(s) 488, 551
SmlI CTYRAG 1 cut(s) 533
SmoI CTYRAG 1 cut(s) 533
SpeI ACTAGT 1 cut(s) 71
SphI GCATGC 1 cut(s) 487
Sse9I AATT 3 cut(s) 453, 556, 605
SseBI AGGCCT 1 cut(s) 585
SspMI CTAG 2 cut(s) 72, 342
StuI AGGCCT 1 cut(s) 585
StyI CCWWGG 2 cut(s) 204, 415
TaaI ACNGT 2 cut(s) 12, 89
TaqI TCGA 1 cut(s) 129
TasI AATT 3 cut(s) 453, 556, 605
TfiI GAWTC 1 cut(s) 25
Tru1I TTAA 2 cut(s) 135, 603
Tru9I TTAA 2 cut(s) 135, 603
TscAI CASTG 1 cut(s) 100
TseFI GTSAC 1 cut(s) 298
TseI GCWGC 3 cut(s) 181, 305, 464
Tsp45I GTSAC 1 cut(s) 298
TspDTI ATGAA 3 cut(s) 60, 374, 569
TspRI CASTG 1 cut(s) 100
VpaK11BI GGWCC 1 cut(s) 79
XceI RCATGY 1 cut(s) 487
XspI CTAG 2 cut(s) 72, 342
Zsp2I ATGCAT 1 cut(s) 403
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.