Rmu_sc0006990.1_g000002

Gamma carbonic anhydrase 1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006990.1
OG0020551
Physical Location & Seq
Forward (+)
10279 .. 11536
1258 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006990.1_g000002.1.cds

Sequence Viewer

Length: 228 bp
atgctcgcgatcgtgtctaggcatcggactcttatgaatgtattcgataaagctcctgttgttgacaaggatgcatttgtggccccaagtgcctccgtcgttggtgatgttcaagtgggaagaggatcttctatttgggatgattgcgaatatgtgtatgaatttattatgcatcgtcgaaaaaaggagatatcgggggatatatcggagatatcgcagagattttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Hexapep

Protein Analysis

75

Amino Acids

8.5

Weight (kDa)

6.04

Isoelectric Point (pI)

43.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020551)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0071351
rosa_laevigata RLG00000002964
rosa_multiflora Rmu_sc0006990.1_g000002
rosa_roxburghii Rroxscaffold_1G00056810
rosa_samantha Rh5AG468000 Rh5CG510900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 8
AclWI GGATC 1 cut(s) 133
AcsI RAATTY 1 cut(s) 161
AgsI TTSAA 1 cut(s) 113
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
AlwI GGATC 1 cut(s) 133
AoxI GGCC 1 cut(s) 81
ApoI RAATTY 1 cut(s) 161
Asp700I GAANNNNTTC 1 cut(s) 41
AspS9I GGNCC 1 cut(s) 82
AsuHPI GGTGA 1 cut(s) 116
BfaI CTAG 1 cut(s) 18
BmgT120I GGNCC 1 cut(s) 82
BmiI GGNNCC 1 cut(s) 84
BmsI GCATC 3 cut(s) 31, 61, 181
BseGI GGATG 2 cut(s) 76, 145
Bsh1236I CGCG 1 cut(s) 8
Bsh1285I CGRYCG 1 cut(s) 12
BshFI GGCC 1 cut(s) 83
BsiEI CGRYCG 1 cut(s) 12
BsnI GGCC 1 cut(s) 83
Bsp143I GATC 2 cut(s) 9, 125
Bsp68I TCGCGA 1 cut(s) 8
BspANI GGCC 1 cut(s) 83
BspFNI CGCG 1 cut(s) 8
BspLI GGNNCC 1 cut(s) 84
BspPI GGATC 1 cut(s) 133
BssMI GATC 2 cut(s) 9, 125
Bst6I CTCTTC 1 cut(s) 115
BstC8I GCNNGC 1 cut(s) 6
BstF5I GGATG 2 cut(s) 76, 145
BstFNI CGCG 1 cut(s) 8
BstKTI GATC 2 cut(s) 12, 128
BstMBI GATC 2 cut(s) 9, 125
BstMCI CGRYCG 1 cut(s) 12
BstMWI GCNNNNNNNGC 2 cut(s) 80, 89
BstUI CGCG 1 cut(s) 8
BstX2I RGATCY 1 cut(s) 125
BstYI RGATCY 1 cut(s) 125
BsuRI GGCC 1 cut(s) 83
BtsCI GGATG 2 cut(s) 76, 145
BtuMI TCGCGA 1 cut(s) 8
Cac8I GCNNGC 1 cut(s) 6
Cfr13I GGNCC 1 cut(s) 82
CviJI RGCY 2 cut(s) 53, 83
CviKI_1 RGCY 2 cut(s) 53, 83
DpnI GATC 2 cut(s) 11, 127
DpnII GATC 2 cut(s) 9, 125
Eam1104I CTCTTC 1 cut(s) 115
EarI CTCTTC 1 cut(s) 115
Eco32I GATATC 2 cut(s) 192, 213
EcoRV GATATC 2 cut(s) 192, 213
EcoT22I ATGCAT 2 cut(s) 76, 174
FaiI YATR 5 cut(s) 35, 153, 159, 170, 203
FalI AAGNNNNNCTT 2 cut(s) 112, 144
FokI GGATG 2 cut(s) 83, 152
FspBI CTAG 1 cut(s) 18
HaeIII GGCC 1 cut(s) 83
HincII GTYRAC 1 cut(s) 64
HindII GTYRAC 1 cut(s) 64
HinfI GANTC 1 cut(s) 28
HphI GGTGA 1 cut(s) 116
Hpy166II GTNNAC 1 cut(s) 64
Hpy188I TCNGA 2 cut(s) 27, 208
Hpy188III TCNNGA 1 cut(s) 7
Hpy8I GTNNAC 1 cut(s) 64
Hpy99I CGWCG 2 cut(s) 101, 180
HpyCH4V TGCA 2 cut(s) 74, 172
HpyF10VI GCNNNNNNNGC 2 cut(s) 80, 89
Kzo9I GATC 2 cut(s) 9, 125
LmnI GCTCC 1 cut(s) 58
LpnPI CCDG 1 cut(s) 69
LweI GCATC 3 cut(s) 31, 61, 181
MaeI CTAG 1 cut(s) 18
MalI GATC 2 cut(s) 11, 127
MboI GATC 2 cut(s) 9, 125
MboII GAAGA 2 cut(s) 120, 132
MflI RGATCY 1 cut(s) 125
MluCI AATT 1 cut(s) 161
MlyI GAGTC 1 cut(s) 22
MnlI CCTC 2 cut(s) 103, 116
Mph1103I ATGCAT 2 cut(s) 76, 174
MroXI GAANNNNTTC 1 cut(s) 41
MvnI CGCG 1 cut(s) 8
MwoI GCNNNNNNNGC 2 cut(s) 80, 89
NdeII GATC 2 cut(s) 9, 125
NlaIV GGNNCC 1 cut(s) 84
NruI TCGCGA 1 cut(s) 8
NsiI ATGCAT 2 cut(s) 76, 174
PdmI GAANNNNTTC 1 cut(s) 41
Ple19I CGATCG 1 cut(s) 12
PleI GAGTC 1 cut(s) 22
PpsI GAGTC 1 cut(s) 22
PspN4I GGNNCC 1 cut(s) 84
PspPI GGNCC 1 cut(s) 82
PsuI RGATCY 1 cut(s) 125
PvuI CGATCG 1 cut(s) 12
RruI TCGCGA 1 cut(s) 8
Sau3AI GATC 2 cut(s) 9, 125
Sau96I GGNCC 1 cut(s) 82
SchI GAGTC 1 cut(s) 22
SetI ASST 1 cut(s) 55
SfaNI GCATC 3 cut(s) 31, 61, 181
SgeI CNNG 9 cut(s) 17, 19, 25, 30, 68, 79, 99, 125, 207
Sse9I AATT 1 cut(s) 161
SspMI CTAG 1 cut(s) 18
TaqI TCGA 2 cut(s) 45, 178
TasI AATT 1 cut(s) 161
TspDTI ATGAA 2 cut(s) 50, 174
TspGWI ACGGA 1 cut(s) 85
XapI RAATTY 1 cut(s) 161
XmnI GAANNNNTTC 1 cut(s) 41
XspI CTAG 1 cut(s) 18
Zsp2I ATGCAT 2 cut(s) 76, 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.