Rmu_sc0008149.1_g000015

glucan endo-13-beta-glucosidase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008149.1
Physical Location & Seq
Reverse (-)
66672 .. 67991
1320 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008149.1_g000015.1.cds

Sequence Viewer

Length: 351 bp
atgctgataaggataacacttgctctgctctttctctcgctagttccactcaaatcagtggatgcagattatgagcaatggtgtatcgccgacgaacaaaccccggatgatgagttgcaggcagcaatagattgggcttgtagtggaggtggaggtgcagattgtagcaagattcagatgaaccaaccttgcttttacccaaacactcttaaagaccatgcttcctatgccttcaacaactacttccagaagttcaaacacaaaggtggatcttgctacttcaaggcagctgccatgattacagaacttgatcctagtcatggcccttgcaagtatgactattttccctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

13.02

Weight (kDa)

4.92

Isoelectric Point (pI)

29.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017090)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G35740
fragaria_vesca FvH4_6g41190
malus_domestica MD09G1121800.v1.1
prunus_persica Prupe.3G201800_v2.0.a1
pyrus_communis pycom09g04620
rosa_chinensis RchiOBHm_Chr2g0156751
rosa_laevigata RLG00000020937
rosa_multiflora Rmu_sc0008149.1_g000015
rosa_roxburghii Rroxscaffold_2G00092760
rosa_rugosa Rorug02G0456100
rosa_samantha Rh2AG521400 Rh2CG506300
rosa_wichuraiana Rw2G043040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 277, 305
AfiI CCNNNNNNNGG 1 cut(s) 320
AgsI TTSAA 3 cut(s) 235, 256, 283
AleI CACNNNNGTG 1 cut(s) 264
AluBI AGCT 1 cut(s) 290
AluI AGCT 1 cut(s) 290
AlwI GGATC 2 cut(s) 277, 305
AoxI GGCC 1 cut(s) 322
ApeKI GCWGC 3 cut(s) 122, 287, 290
AspS9I GGNCC 1 cut(s) 323
AsuC2I CCSGG 1 cut(s) 104
BbvI GCAGC 3 cut(s) 134, 277, 299
BcnI CCSGG 1 cut(s) 104
BfaI CTAG 2 cut(s) 41, 315
BisI GCNGC 3 cut(s) 123, 288, 291
BlsI GCNGC 3 cut(s) 124, 289, 292
Bme1390I CCNGG 1 cut(s) 104
BmgT120I GGNCC 1 cut(s) 323
BmrFI CCNGG 1 cut(s) 104
BmsI GCATC 1 cut(s) 52
BpuMI CCSGG 1 cut(s) 104
BsaJI CCNNGG 1 cut(s) 102
Bsc4I CCNNNNNNNGG 1 cut(s) 320
Bse3DI GCAATG 1 cut(s) 83
BseDI CCNNGG 1 cut(s) 102
BseGI GGATG 2 cut(s) 67, 112
BseLI CCNNNNNNNGG 1 cut(s) 320
BseMI GCAATG 1 cut(s) 83
BseXI GCAGC 3 cut(s) 134, 277, 299
BsgI GTGCAG 1 cut(s) 177
BshFI GGCC 1 cut(s) 324
BsiSI CCGG 1 cut(s) 104
BslI CCNNNNNNNGG 1 cut(s) 320
BsnI GGCC 1 cut(s) 324
Bsp143I GATC 2 cut(s) 269, 310
BspANI GGCC 1 cut(s) 324
BspPI GGATC 2 cut(s) 277, 305
BsrDI GCAATG 1 cut(s) 83
BssECI CCNNGG 1 cut(s) 102
BssMI GATC 2 cut(s) 269, 310
BstC8I GCNNGC 1 cut(s) 120
BstF5I GGATG 2 cut(s) 67, 112
BstKTI GATC 2 cut(s) 272, 313
BstMBI GATC 2 cut(s) 269, 310
BstMWI GCNNNNNNNGC 1 cut(s) 227
BstSCI CCNGG 1 cut(s) 102
BstV1I GCAGC 3 cut(s) 134, 277, 299
BstX2I RGATCY 1 cut(s) 269
BstYI RGATCY 1 cut(s) 269
BsuRI GGCC 1 cut(s) 324
BtsCI GGATG 2 cut(s) 67, 112
BtsIMutI CAGTG 1 cut(s) 63
Cac8I GCNNGC 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 323
CviAII CATG 3 cut(s) 218, 295, 320
CviJI RGCY 3 cut(s) 137, 290, 324
CviKI_1 RGCY 3 cut(s) 137, 290, 324
DpnI GATC 2 cut(s) 271, 312
DpnII GATC 2 cut(s) 269, 310
FaeI CATG 3 cut(s) 221, 298, 323
FaiI YATR 6 cut(s) 72, 219, 228, 296, 321, 336
FatI CATG 3 cut(s) 217, 294, 319
Fnu4HI GCNGC 3 cut(s) 123, 288, 291
FokI GGATG 2 cut(s) 74, 119
Fsp4HI GCNGC 3 cut(s) 123, 288, 291
FspBI CTAG 2 cut(s) 41, 315
GluI GCNGC 3 cut(s) 123, 288, 291
HaeIII GGCC 1 cut(s) 324
HapII CCGG 1 cut(s) 104
Hin1II CATG 3 cut(s) 221, 298, 323
HinfI GANTC 1 cut(s) 172
HpaII CCGG 1 cut(s) 104
Hpy188I TCNGA 1 cut(s) 177
Hpy188III TCNNGA 1 cut(s) 247
Hpy99I CGWCG 1 cut(s) 95
HpyAV CCTTC 1 cut(s) 241
HpyCH4V TGCA 4 cut(s) 65, 118, 158, 330
HpyF10VI GCNNNNNNNGC 1 cut(s) 227
Hsp92II CATG 3 cut(s) 221, 298, 323
Kzo9I GATC 2 cut(s) 269, 310
LpnPI CCDG 3 cut(s) 104, 117, 260
Lsp1109I GCAGC 3 cut(s) 134, 277, 299
LweI GCATC 1 cut(s) 52
MaeI CTAG 2 cut(s) 41, 315
MalI GATC 2 cut(s) 271, 312
MboI GATC 2 cut(s) 269, 310
MflI RGATCY 1 cut(s) 269
MnlI CCTC 2 cut(s) 140, 146
MseI TTAA 1 cut(s) 210
MslI CAYNNNNRTG 1 cut(s) 264
MspA1I CMGCKG 1 cut(s) 290
MspI CCGG 1 cut(s) 104
MspR9I CCNGG 1 cut(s) 104
MwoI GCNNNNNNNGC 1 cut(s) 227
NciI CCSGG 1 cut(s) 104
NdeII GATC 2 cut(s) 269, 310
NlaIII CATG 3 cut(s) 221, 298, 323
OliI CACNNNNGTG 1 cut(s) 264
PfeI GAWTC 1 cut(s) 172
PkrI GCNGC 3 cut(s) 124, 289, 292
PspPI GGNCC 1 cut(s) 323
PsuI RGATCY 1 cut(s) 269
PvuII CAGCTG 1 cut(s) 290
RseI CAYNNNNRTG 1 cut(s) 264
SaqAI TTAA 1 cut(s) 210
SatI GCNGC 3 cut(s) 123, 288, 291
Sau3AI GATC 2 cut(s) 269, 310
Sau96I GGNCC 1 cut(s) 323
ScrFI CCNGG 1 cut(s) 104
SetI ASST 5 cut(s) 151, 157, 190, 268, 292
SfaNI GCATC 1 cut(s) 52
SmiMI CAYNNNNRTG 1 cut(s) 264
SspMI CTAG 2 cut(s) 41, 315
StyD4I CCNGG 1 cut(s) 102
TfiI GAWTC 1 cut(s) 172
Tru1I TTAA 1 cut(s) 210
Tru9I TTAA 1 cut(s) 210
TscAI CASTG 1 cut(s) 63
TseI GCWGC 3 cut(s) 122, 287, 290
TspDTI ATGAA 1 cut(s) 194
TspRI CASTG 1 cut(s) 63
XspI CTAG 2 cut(s) 41, 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.