Rmu_sc0008647.1_g000026

U6 snRNA-associated Sm-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008647.1
Physical Location & Seq
Forward (+)
108328 .. 108926
599 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008647.1_g000026.1.cds

Sequence Viewer

Length: 279 bp
atgagcggagcaggagcagagagaggatctggaaccacaaaaactcctgcagattttcttaaatcaattcgggggcgaccggttgttgttaaactgaattctggtgttgactatcgaggtattctggcttgtcttgatgggtatatgaatatagccatggagcaaacagaggaatatgtcaatggacagctgaaaaataagtatggtgatgcttttattcgtggaaataatgttctctacatcagcacaacaaagatgacaatagcagatggggcatag

Protein Analysis

92

Amino Acids

9.88

Weight (kDa)

8.79

Isoelectric Point (pI)

31.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 6
AciI CCGC 1 cut(s) 6
AclWI GGATC 1 cut(s) 34
AcsI RAATTY 1 cut(s) 97
AgeI ACCGGT 1 cut(s) 79
AloI GAACNNNNNNTCC 2 cut(s) 216, 248
AluBI AGCT 1 cut(s) 190
AluI AGCT 1 cut(s) 190
AlwI GGATC 1 cut(s) 34
ApoI RAATTY 1 cut(s) 97
AsiGI ACCGGT 1 cut(s) 79
AsuHPI GGTGA 1 cut(s) 218
BccI CCATC 2 cut(s) 131, 263
BfmI CTRYAG 1 cut(s) 48
BmiI GGNNCC 1 cut(s) 34
BmsI GCATC 1 cut(s) 199
BsaJI CCNNGG 1 cut(s) 156
BsaWI WCCGGW 1 cut(s) 79
BsaXI ACNNNNNCTCC 2 cut(s) 28, 58
Bse118I RCCGGY 1 cut(s) 79
BseDI CCNNGG 1 cut(s) 156
Bsh1285I CGRYCG 1 cut(s) 80
BshTI ACCGGT 1 cut(s) 79
BsiEI CGRYCG 1 cut(s) 80
BsiSI CCGG 1 cut(s) 80
Bsp143I GATC 1 cut(s) 26
Bsp19I CCATGG 1 cut(s) 156
BspACI CCGC 1 cut(s) 6
BspLI GGNNCC 1 cut(s) 34
BspMAI CTGCAG 1 cut(s) 52
BspPI GGATC 1 cut(s) 34
BsrBI CCGCTC 1 cut(s) 6
BsrFI RCCGGY 1 cut(s) 79
BssAI RCCGGY 1 cut(s) 79
BssECI CCNNGG 1 cut(s) 156
BssMI GATC 1 cut(s) 26
BssT1I CCWWGG 1 cut(s) 156
BstDSI CCRYGG 1 cut(s) 156
BstKTI GATC 1 cut(s) 29
BstMBI GATC 1 cut(s) 26
BstMCI CGRYCG 1 cut(s) 80
BstMWI GCNNNNNNNGC 1 cut(s) 272
BstSFI CTRYAG 1 cut(s) 48
BstX2I RGATCY 1 cut(s) 26
BstYI RGATCY 1 cut(s) 26
BtgI CCRYGG 1 cut(s) 156
Cfr10I RCCGGY 1 cut(s) 79
CspAI ACCGGT 1 cut(s) 79
CviAII CATG 1 cut(s) 157
CviJI RGCY 3 cut(s) 128, 155, 190
CviKI_1 RGCY 3 cut(s) 128, 155, 190
DpnI GATC 1 cut(s) 28
DpnII GATC 1 cut(s) 26
Eco130I CCWWGG 1 cut(s) 156
EcoRI GAATTC 1 cut(s) 97
EcoT14I CCWWGG 1 cut(s) 156
ErhI CCWWGG 1 cut(s) 156
FaeI CATG 1 cut(s) 160
FaiI YATR 7 cut(s) 144, 146, 152, 158, 177, 204, 277
FatI CATG 1 cut(s) 156
HapII CCGG 1 cut(s) 80
Hin1II CATG 1 cut(s) 160
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
HpaII CCGG 1 cut(s) 80
HphI GGTGA 1 cut(s) 218
Hpy166II GTNNAC 1 cut(s) 109
Hpy188III TCNNGA 2 cut(s) 30, 134
Hpy8I GTNNAC 1 cut(s) 109
HpyCH4V TGCA 1 cut(s) 50
HpyF10VI GCNNNNNNNGC 1 cut(s) 272
Hsp92II CATG 1 cut(s) 160
Kzo9I GATC 1 cut(s) 26
LmnI GCTCC 3 cut(s) 8, 14, 160
LpnPI CCDG 5 cut(s) 15, 60, 87, 93, 110
LweI GCATC 1 cut(s) 199
MalI GATC 1 cut(s) 28
MbiI CCGCTC 1 cut(s) 6
MboI GATC 1 cut(s) 26
MflI RGATCY 1 cut(s) 26
MluCI AATT 2 cut(s) 66, 97
MnlI CCTC 3 cut(s) 17, 110, 163
MseI TTAA 2 cut(s) 60, 90
MspA1I CMGCKG 1 cut(s) 190
MspI CCGG 1 cut(s) 80
MwoI GCNNNNNNNGC 1 cut(s) 272
NcoI CCATGG 1 cut(s) 156
NdeII GATC 1 cut(s) 26
NlaIII CATG 1 cut(s) 160
NlaIV GGNNCC 1 cut(s) 34
PinAI ACCGGT 1 cut(s) 79
PspN4I GGNNCC 1 cut(s) 34
PstI CTGCAG 1 cut(s) 52
PsuI RGATCY 1 cut(s) 26
PvuII CAGCTG 1 cut(s) 190
SaqAI TTAA 2 cut(s) 60, 90
Sau3AI GATC 1 cut(s) 26
SetI ASST 2 cut(s) 121, 192
SfaNI GCATC 1 cut(s) 199
SfcI CTRYAG 1 cut(s) 48
Sse9I AATT 2 cut(s) 66, 97
SsiI CCGC 1 cut(s) 6
StyI CCWWGG 1 cut(s) 156
TaqI TCGA 1 cut(s) 115
TasI AATT 2 cut(s) 66, 97
Tru1I TTAA 2 cut(s) 60, 90
Tru9I TTAA 2 cut(s) 60, 90
TspDTI ATGAA 1 cut(s) 161
XapI RAATTY 1 cut(s) 97
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.