Rmu_sc0008805.1_g000002

Callose synthase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008805.1
Physical Location & Seq
Forward (+)
4092 .. 9389
5298 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008805.1_g000002.1.cds

Sequence Viewer

Length: 5298 bp
atgaatctccggcaacggacaccggccacgcgcgccaacgcgcggccggagatgcaagaggccttcaacataatccccatccacaacctgctcgccgaccacccctccctccgctaccctgagatacgcgccgccgcggccaccctacgctccgtcggggacctccggaagccgccgttcgtgcagtggaaaagcgactacgacctgatgaactggctcggaatcttcttcgggttccaaatcgacaacgttcggaaccagcgggagcacctggtcctccacctcgccaactcccaaatgcagctccagcctccgcccaacctcgccgacgtcctcgaggccggcgtcctccgccgcttccgccgcaaattgctgggaaactacacctcctggtgcgcctacctcggccgcagatcaaacgtcatcgtttcccgtcgccgccccgaccatctccgccgcgagctgctctacgtggcgctgtacctgctcgtctggggtgagtccggtaacctaagatttactcccgagtgtatttgttacatttaccatcatatggctatggagctcaatcaggtccttgacgaggacattgacgccgagacgggtcggccctttgtcccctctgtctccggtgaaaatgcttttttgaagagtgtgattatgccgatttacgctactattaaggatgaggttgagagcagtagaaatggcaccaggccgcactcggcctggcgcaactatgatgatatcaacgagtacttttggtccaggaggtgtttcaggagtctcaaatggcctcttaattactctagtaattttctcagtacaactcccaaggggagcagggtggggaagactgggtttgtggagcagaggtcgttttggaatctgtttaggagcttcgacaagctgtgggtgttgttgtttttgtttttgcaagctagtcttattgtggcttgggaggggaaagagtatccctggacggcattggagagtagggacgtgcaggtgcggttgttgactgtgtttattacttggggaggccttagggtgcttcaggcagtgcttgatgctgggactcagtatagtttggtgacgagggagactatgttgcttggggtgagaatggtgctaaaggcggcggttgcaataacgtggactattctatttgcggtgttttatgcgggcatttgggctcagaagaattccgatggtaggtggtctactgaagcaaatagcaagattgttgatttttgttgggctgtactggtttttgttattccagaattgctggcattggttctgtttatagttccttgggtgaggaacttcattgaagagttaaattgtaatgcaatttatgtgtttacatggtggtttcacacccggatttttgttggtcgcgcactgagggaagggcttgtcagtaatgtcaaatacacagtgttctggattatcgtgttggcttcaaagtttggtttcagttatttccttcagatcaagccgcttgttaacacgacaaagagtctcatgaagattaaggttcacacatacaagatgcatgttttttttgaggggactaatgtaatagcagttgtgttgttgtggattccggttctgttgatttacctgatggatctgcagatatggtatgccattcactcatcctttattggtgcaacaattgggctgttttcacatttgggggagataaggaatatcaaacagctgaggcttaggtttcagttttttgctagtgcattgcaatttaatctcatgccagaggagcagtcattacgtcctgagctgacaatggtgaagaaactccgcgatgccatacacaggctgaagttgcggtatgggcttggtcaagcctacaagaagactgaatcaagccaaatagaagctaccaggtttgccttgatatggaatgaaatcatgacaactttcagggaggaagatcttatcagtgatcgagaacttgagctcatggaactgccacctaattgttggcacattagagttattcgctggccgtgtttcctccttgcaaatgaactattgcttgctctgcgtcaggcaacggagccggcagacgaacctgatcagttgctttggttgaggatatgcaagagtgagtatcggcgctgtgctatcgttgaagcttatgatagcataaggtatctgcttcttacggttgttagacatggcacagaagaaaattccatcattgaccattttttcagggagatagatcaatgtattgaaaatcagaagttcgtggttacgtacaggatgtctctgcttccgcaaattcatgccaagttaatttctcttattgaccttctgctgcaattaaagaaagatacaagtaagacagtggatatattgcaggccctgtatgaactctctgttcgtgaattcccaaaggtgaagaggtccatgcagacattgagggtggaaggcctggcaactcgtagtagatccactgaagaaggcttgctttttgaaaatgcgattcagtttcctgatgatgaggatgcaaccttctttaggcatctgcgacgtctgcatacaattctcacttctagagactcgatgcacaatgtcccagtgaatattgatgcaagaaagcgcattgctttctttagcaattcacttttcatgaatatgccccgtgctccctatgttgagaaaatgatggctttcagtgtcctgactccatattatgatgaggaagtgttgtatggcaaagaatctcttcgatctgagaatgaagatgggatttccaccttgttttatctgcagaagatttatgaaggtgagtggacgaactttctggaacggatgtacagagagggcatgaagaatgacgaggaactctttactacgaaggcaagggatctccgcgtttgggcatcatacaggggccagacattatcgcgtactgtgagaggaatgatgtactactatagggcactgaagatgcttgcctttcttgattctgcatctgagatggatataagggatggatcacagcaagttgcctctcatggtttgatgacccacaataacattatggatggtgtacagtcaggtttgcaaccagcttcacaaaaactcggaagaacagccagtgtgagttacttattcaagggccatgaacatggcattgctctgttgaaatttacgtatgtggttgcctgccaactatatgggcagcataaggctaagggagatcaccgtgctgaggagatattatttctgatgaaaaacaatgaggcccttcgagtggcctatgttgataaggttgagttggggagagatgaggttgagtattactctgtgcttgttaaatatgatcagcagatccaaagcgaggtagagatctatcggatcaggttgcctggtcccctgaagctcggtgaaggtaaaccagagaatcaaaaccatgccataatctttaccaggggtgatgcaattcagacaattgacatgaaccaagacaattcttttgaggaggcactcaaaatgcggaatttgctggaggaattcaagaacttttatggcctcagaaagccaactatcttgggtgtccgtgaggatatcttcacaggttctgtatcatcccttgcttggttcatgtctgctcaggagatgagttttgtgaccctgaaccagcgtgttctggcaaaccctttgaaggtgcgaatgcactatggtcacccagatgtgtttgacaggttctggttcttgcagcggggtggaatcagcaaggcttctaaagttatcaatatcagtgaggacatatttgctggcttcaattgcacactgcgaggtggcaatgtgactcaccatgaatatatacaggtgggcaagggaagggatgttgggttgaatcagatctccatgtttgaggccaaggttgctagtggcaacggtgagcaggctttgagcagagatgtgtatcgattgggtcatagattggacttctttcggatgctttcatttttctattcgactgttgggttctactttaacacgatgatagtggtactgactgtttattcattcttgtggggccgcctttttcttgctctcagtggtgtcgaggacgatcttgacacaagcaacaataaagcagttggtgtgatgttaaatcagcagttcattatccagctagggctgttcaccgcccttccaatgattgttgagaactctctcgaacagggtttccttacagcagtttgggagttcttaacaatgcagttgcagcttgcttcagtcttttacacattctccatgggaacccgtacccattactttggtcgtactattcttcatgggggtgcaaagtaccgagcaactggacgtggctttgtggtccagcacaagagctttgctgagaactatcgactctactctcgcagccattttgtgaaggcaattgagcttgcgattattttagtagtgtatgctgctcatagcagcgtggctcgagatacctttgtttacattggcatgagtatctcaagctggtttctggtagtgtcatggatgctggctccctttatttttaacccttctggatttgattggctgaaaactgtctatgactttgatgattttataagttggttatggtattctggaggggtgtttacaaaagctgaactgagctgggaaacatggtggtatgaggaacaggaccatttgagaacaactgggctttggggaaagctgttggaaattattttggatcttcgtttcttcttcttccagtatggtgttgtgtatcaactaggtattgtccatggagacaaaagtataggtgtttacttgctgtcttggatatacatggttgtagctgttgggatttatatgaccatatcctggtctcagaacaaatatgcagcgaaggaacatatatactaccggctagttcagctttgtgtcataatggttatggtactctttattgttttactgctggagttcactagattcaagttccttgacattctctcaagtctcttggcattcatccctactggctggggtataattttaatagctcaagtgcttagaccttttctgcagaccacagtggtgtgggatactgtggtttccttggctcgaatttatgatatgctttttggagtaactgttatggctcctgtggcgctgctgtcatggttacctggatttcagtcaatgcagaccaggatcttgttcaatgaagcattcagcagaggtctccagatatctcgtatccttactggcaaaaagtctaactga
Functional Annotation

Protein Analysis

1765

Amino Acids

204.86

Weight (kDa)

8.96

Isoelectric Point (pI)

42.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012885)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 4631
AarI CACCTGC 1 cut(s) 997
AatII GACGTC 2 cut(s) 333, 2569
AbsI CCTCGAGG 1 cut(s) 335
Acc36I ACCTGC 3 cut(s) 96, 492, 997
AccB1I GGYRCC 1 cut(s) 710
AccB7I CCANNNNNTGG 2 cut(s) 553, 4893
AccI GTMKAC 1 cut(s) 1223
AccIII TCCGGA 1 cut(s) 165
AclI AACGTT 1 cut(s) 249
AclWI GGATC 8 cut(s) 1644, 2478, 2910, 3040, 3364, 3404, 4767, 5234
AcoI YGGCCR 5 cut(s) 24, 44, 138, 406, 2033
AcsI RAATTY 8 cut(s) 1204, 2221, 2313, 2420, 3185, 3538, 3551, 5139
AcuI CTGAAG 8 cut(s) 1040, 1248, 1478, 1868, 2511, 3002, 3437, 4266
AcyI GRCGYC 4 cut(s) 330, 345, 594, 2566
AhdI GACNNNNNGTC 1 cut(s) 1524
AjiI CACGTC 2 cut(s) 1003, 4373
AleI CACNNNNGTG 1 cut(s) 5108
AloI GAACNNNNNNTCC 2 cut(s) 4218, 4250
Alw21I GWGCWC 4 cut(s) 270, 567, 1989, 2683
AlwI GGATC 8 cut(s) 1644, 2478, 2910, 3040, 3364, 3404, 4767, 5234
AlwNI CAGNNNCTG 3 cut(s) 2398, 3620, 3747
Ama87I CYCGRG 3 cut(s) 335, 524, 4497
Aor13HI TCCGGA 1 cut(s) 165
ApoI RAATTY 8 cut(s) 1204, 2221, 2313, 2420, 3185, 3538, 3551, 5139
ArsI GACNNNNNNTTYG 2 cut(s) 3497, 3529
Asp700I GAANNNNTTC 1 cut(s) 2760
AsuC2I CCSGG 1 cut(s) 1387
AvaI CYCGRG 3 cut(s) 335, 524, 4497
AvaII GGWCC 8 cut(s) 160, 274, 574, 765, 2439, 3410, 4384, 4708
AxyI CCTNAGG 1 cut(s) 1046
BaeGI GKGCMC 1 cut(s) 2980
BaeI ACNNNNGTAYC 4 cut(s) 4494, 4527, 5109, 5142
BanI GGYRCC 1 cut(s) 710
BanII GRGCYC 3 cut(s) 567, 1198, 1989
BbsI GAAGAC 2 cut(s) 860, 1889
Bbv12I GWGCWC 4 cut(s) 270, 567, 1989, 2683
BbvCI CCTCAGC 2 cut(s) 1730, 3249
BceAI ACGGC 3 cut(s) 160, 999, 2020
BciVI GTATCC 3 cut(s) 984, 5110, 5282
BclI TGATCA 2 cut(s) 2104, 3361
BcnI CCSGG 1 cut(s) 1387
BfaI CTAG 9 cut(s) 810, 942, 1755, 2589, 3930, 4181, 4802, 4940, 5001
BfmI CTRYAG 4 cut(s) 1640, 2804, 2971, 5096
BfoI RGCGCY 3 cut(s) 479, 2149, 5186
BfuAI ACCTGC 3 cut(s) 96, 492, 997
BfuI GTATCC 3 cut(s) 984, 5110, 5282
BglI GCCNNNNNGGC 1 cut(s) 137
BglII AGATCT 3 cut(s) 1960, 3387, 3903
BmcAI AGTACT 1 cut(s) 758
Bme18I GGWCC 8 cut(s) 160, 274, 574, 765, 2439, 3410, 4384, 4708
BmeRI GACNNNNNGTC 1 cut(s) 1524
BmeT110I CYCGRG 3 cut(s) 335, 524, 4497
BmgBI CACGTC 2 cut(s) 1003, 4373
BmrI ACTGGG 3 cut(s) 867, 2606, 4734
BmuI ACTGGG 3 cut(s) 867, 2606, 4734
BpiI GAAGAC 2 cut(s) 860, 1889
BplI GAGNNNNNCTC 2 cut(s) 3326, 3358
BpmI CTGGAG 5 cut(s) 290, 3566, 4671, 5012, 5243
Bpu10I CCTNAGC 6 cut(s) 1730, 1736, 1803, 3231, 3249, 3651
BpuEI CTTGAG 4 cut(s) 2003, 4516, 5011, 5061
BpuMI CCSGG 1 cut(s) 1387
Bsa29I ATCGAT 1 cut(s) 3970
BsaAI YACGTR 3 cut(s) 472, 2289, 3192
BsaBI GATNNNNATC 1 cut(s) 3966
BsaHI GRCGYC 4 cut(s) 330, 345, 594, 2566
BsaI GGTCTC 2 cut(s) 4902, 5261
BsaWI WCCGGW 4 cut(s) 165, 503, 629, 1612
Bse118I RCCGGY 4 cut(s) 22, 341, 2089, 4935
Bse21I CCTNAGG 1 cut(s) 1046
Bse3DI GCAATG 4 cut(s) 1760, 2637, 3171, 3850
Bse8I GATNNNNATC 1 cut(s) 3966
BseAI TCCGGA 1 cut(s) 165
BseCI ATCGAT 1 cut(s) 3970
BseJI GATNNNNATC 1 cut(s) 3966
BseMI GCAATG 4 cut(s) 1760, 2637, 3171, 3850
BsePI GCGCGC 1 cut(s) 31
BseRI GAGGAG 3 cut(s) 1799, 3266, 3533
BseSI GKGCMC 1 cut(s) 2980
BseX3I CGGCCG 2 cut(s) 44, 406
BseYI CCCAGC 4 cut(s) 373, 1073, 4680, 5055
BsgI GTGCAG 2 cut(s) 203, 1025
Bsh1285I CGRYCG 2 cut(s) 47, 409
BshNI GGYRCC 1 cut(s) 710
BshVI ATCGAT 1 cut(s) 3970
BsiEI CGRYCG 2 cut(s) 47, 409
BsiHKAI GWGCWC 4 cut(s) 270, 567, 1989, 2683
BsiHKCI CYCGRG 3 cut(s) 335, 524, 4497
BslFI GGGAC 7 cut(s) 173, 602, 1013, 1090, 1591, 2594, 3396
BsmBI CGTCTC 1 cut(s) 593
BsmFI GGGAC 7 cut(s) 173, 602, 1013, 1090, 1591, 2594, 3396
BsmI GAATGC 3 cut(s) 3717, 5039, 5243
Bso31I GGTCTC 2 cut(s) 4902, 5261
BsoBI CYCGRG 3 cut(s) 335, 524, 4497
Bsp1286I GDGCHC 6 cut(s) 270, 567, 1198, 1989, 2683, 2980
Bsp13I TCCGGA 1 cut(s) 165
Bsp1407I TGTACA 2 cut(s) 2850, 3088
Bsp19I CCATGG 2 cut(s) 4302, 4813
BspDI ATCGAT 1 cut(s) 3970
BspEI TCCGGA 1 cut(s) 165
BspHI TCATGA 3 cut(s) 1530, 1938, 2664
BspMAI CTGCAG 3 cut(s) 1644, 2808, 5100
BspMI ACCTGC 3 cut(s) 96, 492, 997
BspPI GGATC 8 cut(s) 1644, 2478, 2910, 3040, 3364, 3404, 4767, 5234
BspT107I GGYRCC 1 cut(s) 710
BspTNI GGTCTC 2 cut(s) 4902, 5261
BsrDI GCAATG 4 cut(s) 1760, 2637, 3171, 3850
BsrFI RCCGGY 4 cut(s) 22, 341, 2089, 4935
BsrGI TGTACA 2 cut(s) 2850, 3088
BssAI RCCGGY 4 cut(s) 22, 341, 2089, 4935
BssHII GCGCGC 1 cut(s) 31
BssNI GRCGYC 4 cut(s) 330, 345, 594, 2566
BssT1I CCWWGG 6 cut(s) 834, 1316, 3921, 4302, 4813, 5130
Bst6I CTCTTC 4 cut(s) 644, 1332, 2429, 2766
BstACI GRCGYC 4 cut(s) 330, 345, 594, 2566
BstAUI TGTACA 2 cut(s) 2850, 3088
BstBAI YACGTR 3 cut(s) 472, 2289, 3192
BstDSI CCRYGG 3 cut(s) 135, 4302, 4813
BstEII GGTNACC 3 cut(s) 506, 3722, 5196
BstENI CCTNNNNNAGG 2 cut(s) 581, 2551
BstH2I RGCGCY 3 cut(s) 479, 2149, 5186
BstMCI CGRYCG 2 cut(s) 47, 409
BstNSI RCATGY 1 cut(s) 1565
BstPI GGTNACC 3 cut(s) 506, 3722, 5196
BstSFI CTRYAG 4 cut(s) 1640, 2804, 2971, 5096
BstSLI GKGCMC 1 cut(s) 2980
BstSNI TACGTA 2 cut(s) 2289, 3192
BstV2I GAAGAC 2 cut(s) 860, 1889
BstX2I RGATCY 9 cut(s) 1636, 1960, 2483, 2902, 3369, 3387, 3903, 4759, 5226
BstXI CCANNNNNNTGG 3 cut(s) 3167, 3215, 4325
BstYI RGATCY 9 cut(s) 1636, 1960, 2483, 2902, 3369, 3387, 3903, 4759, 5226
BstZI CGGCCG 2 cut(s) 44, 406
Bsu15I ATCGAT 1 cut(s) 3970
Bsu36I CCTNAGG 1 cut(s) 1046
BsuI GTATCC 3 cut(s) 984, 5110, 5282
BsuTUI ATCGAT 1 cut(s) 3970
BtgI CCRYGG 3 cut(s) 135, 4302, 4813
BtgZI GCGATG 1 cut(s) 1845
BtrI CACGTC 2 cut(s) 1003, 4373
BtsI GCAGTG 3 cut(s) 191, 1068, 3830
BveI ACCTGC 3 cut(s) 96, 492, 997
CaiI CAGNNNCTG 3 cut(s) 2398, 3620, 3747
CciI TCATGA 3 cut(s) 1530, 1938, 2664
Cfr10I RCCGGY 4 cut(s) 22, 341, 2089, 4935
Cfr42I CCGCGG 1 cut(s) 138
ClaI ATCGAT 1 cut(s) 3970
CseI GACGC 3 cut(s) 334, 602, 2063
CsiI ACCWGGT 2 cut(s) 270, 1910
DriI GACNNNNNGTC 1 cut(s) 1524
EaeI YGGCCR 5 cut(s) 24, 44, 138, 406, 2033
EagI CGGCCG 2 cut(s) 44, 406
Eam1104I CTCTTC 4 cut(s) 644, 1332, 2429, 2766
Eam1105I GACNNNNNGTC 1 cut(s) 1524
EarI CTCTTC 4 cut(s) 644, 1332, 2429, 2766
EciI GGCGGA 4 cut(s) 303, 341, 350, 443
Ecl136II GAGCTC 2 cut(s) 565, 1987
EclXI CGGCCG 2 cut(s) 44, 406
Eco105I TACGTA 2 cut(s) 2289, 3192
Eco130I CCWWGG 6 cut(s) 834, 1316, 3921, 4302, 4813, 5130
Eco147I AGGCCT 3 cut(s) 62, 1044, 2466
Eco24I GRGCYC 3 cut(s) 567, 1198, 1989
Eco31I GGTCTC 2 cut(s) 4902, 5261
Eco32I GATATC 3 cut(s) 748, 3607, 5265
Eco47I GGWCC 8 cut(s) 160, 274, 574, 765, 2439, 3410, 4384, 4708
Eco52I CGGCCG 2 cut(s) 44, 406
Eco53kI GAGCTC 2 cut(s) 565, 1987
Eco57I CTGAAG 8 cut(s) 1040, 1248, 1478, 1868, 2511, 3002, 3437, 4266
Eco81I CCTNAGG 1 cut(s) 1046
Eco88I CYCGRG 3 cut(s) 335, 524, 4497
Eco91I GGTNACC 3 cut(s) 506, 3722, 5196
EcoICRI GAGCTC 2 cut(s) 565, 1987
EcoNI CCTNNNNNAGG 2 cut(s) 581, 2551
EcoO109I RGGNCCY 4 cut(s) 160, 574, 2395, 3283
EcoO65I GGTNACC 3 cut(s) 506, 3722, 5196
EcoRI GAATTC 3 cut(s) 1204, 2420, 3551
EcoRV GATATC 3 cut(s) 748, 3607, 5265
EcoT14I CCWWGG 6 cut(s) 834, 1316, 3921, 4302, 4813, 5130
EcoT22I ATGCAT 1 cut(s) 1563
EcoT38I GRGCYC 3 cut(s) 567, 1198, 1989
ErhI CCWWGG 6 cut(s) 834, 1316, 3921, 4302, 4813, 5130
Esp3I CGTCTC 1 cut(s) 593
FalI AAGNNNNNCTT 6 cut(s) 930, 962, 2487, 2519, 2745, 2777
FaqI GGGAC 7 cut(s) 173, 602, 1013, 1090, 1591, 2594, 3396
FauI CCCGC 3 cut(s) 255, 1177, 3753
FauNDI CATATG 1 cut(s) 552
FbaI TGATCA 2 cut(s) 2104, 3361
FblI GTMKAC 1 cut(s) 1223
FriOI GRGCYC 3 cut(s) 567, 1198, 1989
FspBI CTAG 9 cut(s) 810, 942, 1755, 2589, 3930, 4181, 4802, 4940, 5001
GsaI CCCAGC 4 cut(s) 377, 1077, 4684, 5059
GsuI CTGGAG 5 cut(s) 290, 3566, 4671, 5012, 5243
HaeII RGCGCY 3 cut(s) 479, 2149, 5186
HgaI GACGC 3 cut(s) 334, 602, 2063
Hin1I GRCGYC 4 cut(s) 330, 345, 594, 2566
HincII GTYRAC 2 cut(s) 1020, 1513
HindII GTYRAC 2 cut(s) 1020, 1513
HindIII AAGCTT 1 cut(s) 2163
HpaI GTTAAC 1 cut(s) 1513
Hpy99I CGWCG 4 cut(s) 158, 332, 438, 2568
Hsp92I GRCGYC 4 cut(s) 330, 345, 594, 2566
Kpn2I TCCGGA 1 cut(s) 165
KroI GCCGGC 2 cut(s) 341, 2089
KroNI GCCGGC 2 cut(s) 343, 2091
Ksp22I TGATCA 2 cut(s) 2104, 3361
KspAI GTTAAC 1 cut(s) 1513
KspI CCGCGG 1 cut(s) 138
MabI ACCWGGT 2 cut(s) 270, 1910
MaeI CTAG 9 cut(s) 810, 942, 1755, 2589, 3930, 4181, 4802, 4940, 5001
MfeI CAATTG 4 cut(s) 1683, 3489, 3823, 4446
MflI RGATCY 9 cut(s) 1636, 1960, 2483, 2902, 3369, 3387, 3903, 4759, 5226
MhlI GDGCHC 6 cut(s) 270, 567, 1198, 1989, 2683, 2980
MlyI GAGTC 8 cut(s) 509, 793, 1072, 1534, 2588, 2713, 3844, 4410
MmeI TCCRAC 1 cut(s) 4725
Mph1103I ATGCAT 1 cut(s) 1563
MroI TCCGGA 1 cut(s) 165
MroNI GCCGGC 2 cut(s) 341, 2089
MroXI GAANNNNTTC 1 cut(s) 2760
MslI CAYNNNNRTG 7 cut(s) 2669, 3165, 3729, 4075, 4347, 4520, 5108
MspA1I CMGCKG 4 cut(s) 137, 262, 1729, 3760
MunI CAATTG 4 cut(s) 1683, 3489, 3823, 4446
Mva1269I GAATGC 3 cut(s) 3717, 5039, 5243
NaeI GCCGGC 2 cut(s) 343, 2091
NciI CCSGG 1 cut(s) 1387
NcoI CCATGG 2 cut(s) 4302, 4813
NdeI CATATG 1 cut(s) 552
NgoMIV GCCGGC 2 cut(s) 341, 2089
NmeAIII GCCGAG 3 cut(s) 384, 622, 704
NmuCI GTSAC 4 cut(s) 1093, 3667, 3722, 3847
NsiI ATGCAT 1 cut(s) 1563
NspI RCATGY 1 cut(s) 1565
OliI CACNNNNGTG 1 cut(s) 5108
PaeR7I CTCGAG 2 cut(s) 335, 4497
PagI TCATGA 3 cut(s) 1530, 1938, 2664
PaqCI CACCTGC 1 cut(s) 997
PauI GCGCGC 1 cut(s) 31
PceI AGGCCT 3 cut(s) 62, 1044, 2466
PcsI WCGNNNNNNNCGW 1 cut(s) 342
PctI GAATGC 3 cut(s) 3717, 5039, 5243
PdiI GCCGGC 2 cut(s) 343, 2091
PdmI GAANNNNTTC 1 cut(s) 2760
PflMI CCANNNNNTGG 2 cut(s) 553, 4893
PfoI TCCNGGA 1 cut(s) 767
PleI GAGTC 8 cut(s) 508, 792, 1072, 1533, 2588, 2713, 3844, 4410
PpsI GAGTC 8 cut(s) 508, 792, 1072, 1533, 2588, 2713, 3844, 4410
Ppu21I YACGTR 3 cut(s) 472, 2289, 3192
PpuMI RGGWCCY 2 cut(s) 160, 574
PsiI TTATAA 1 cut(s) 4631
Psp124BI GAGCTC 2 cut(s) 567, 1989
Psp1406I AACGTT 1 cut(s) 249
Psp5II RGGWCCY 2 cut(s) 160, 574
PspEI GGTNACC 3 cut(s) 506, 3722, 5196
PspFI CCCAGC 4 cut(s) 373, 1073, 4680, 5055
PspPPI RGGWCCY 2 cut(s) 160, 574
PspXI VCTCGAGB 1 cut(s) 335
PstI CTGCAG 3 cut(s) 1644, 2808, 5100
PstNI CAGNNNCTG 3 cut(s) 2398, 3620, 3747
PsuI RGATCY 9 cut(s) 1636, 1960, 2483, 2902, 3369, 3387, 3903, 4759, 5226
PteI GCGCGC 1 cut(s) 31
PvuII CAGCTG 1 cut(s) 1729
RseI CAYNNNNRTG 7 cut(s) 2669, 3165, 3729, 4075, 4347, 4520, 5108
SacI GAGCTC 2 cut(s) 567, 1989
SacII CCGCGG 1 cut(s) 138
ScaI AGTACT 1 cut(s) 758
SchI GAGTC 8 cut(s) 509, 793, 1072, 1534, 2588, 2713, 3844, 4410
SduI GDGCHC 6 cut(s) 270, 567, 1198, 1989, 2683, 2980
SexAI ACCWGGT 2 cut(s) 270, 1910
SfcI CTRYAG 4 cut(s) 1640, 2804, 2971, 5096
Sfr274I CTCGAG 2 cut(s) 335, 4497
Sfr303I CCGCGG 1 cut(s) 138
SgrBI CCGCGG 1 cut(s) 138
SinI GGWCC 8 cut(s) 160, 274, 574, 765, 2439, 3410, 4384, 4708
SlaI CTCGAG 2 cut(s) 335, 4497
SmiMI CAYNNNNRTG 7 cut(s) 2669, 3165, 3729, 4075, 4347, 4520, 5108
SmlI CTYRAG 6 cut(s) 335, 1982, 4497, 4531, 5026, 5076
SmoI CTYRAG 6 cut(s) 335, 1982, 4497, 4531, 5026, 5076
SnaBI TACGTA 2 cut(s) 2289, 3192
SseBI AGGCCT 3 cut(s) 62, 1044, 2466
SspI AATATT 1 cut(s) 2620
SspMI CTAG 9 cut(s) 810, 942, 1755, 2589, 3930, 4181, 4802, 4940, 5001
SstI GAGCTC 2 cut(s) 567, 1989
StuI AGGCCT 3 cut(s) 62, 1044, 2466
StyI CCWWGG 6 cut(s) 834, 1316, 3921, 4302, 4813, 5130
TatI WGTACW 6 cut(s) 756, 824, 1264, 2850, 2964, 3088
TseFI GTSAC 4 cut(s) 1093, 3667, 3722, 3847
Tsp45I GTSAC 4 cut(s) 1093, 3667, 3722, 3847
TspGWI ACGGA 5 cut(s) 31, 142, 2099, 2860, 3587
Van91I CCANNNNNTGG 2 cut(s) 553, 4893
VpaK11BI GGWCC 8 cut(s) 160, 274, 574, 765, 2439, 3410, 4384, 4708
XagI CCTNNNNNAGG 2 cut(s) 581, 2551
XapI RAATTY 8 cut(s) 1204, 2221, 2313, 2420, 3185, 3538, 3551, 5139
XbaI TCTAGA 1 cut(s) 2588
XceI RCATGY 1 cut(s) 1565
XcmI CCANNNNNNNNNTGG 1 cut(s) 2007
XhoI CTCGAG 2 cut(s) 335, 4497
XmiI GTMKAC 1 cut(s) 1223
XmnI GAANNNNTTC 1 cut(s) 2760
XspI CTAG 9 cut(s) 810, 942, 1755, 2589, 3930, 4181, 4802, 4940, 5001
ZraI GACGTC 2 cut(s) 331, 2567
ZrmI AGTACT 1 cut(s) 758
Zsp2I ATGCAT 1 cut(s) 1563
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.