Rmu_sc0009715.1_g000003

RNA-binding protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009715.1
Physical Location & Seq
Forward (+)
14936 .. 17224
2289 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009715.1_g000003.1.cds

Sequence Viewer

Length: 345 bp
atgtcatcactcgacaaggttggcaatgttccagtatctgttactaaaataccattgatctccattgattacgaaccaccaagtactaagtcatttaaaaccatagaagcatcagcgaggatcgatgctatagctagtgcaggatttaagatttcacggtcaaaactagttgacctgatccgtgatggggatgttcgcctcaactggaccccagttactaaaaatggagctacactcaaggctggtgatattgtatcagttcgaggaaaaggaagactgaagataggagaaattaacacgacaaggaaggggaagtttgcaatagagcttattcgttatttgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

12.39

Weight (kDa)

10.11

Isoelectric Point (pI)

15.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011251)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 128, 172
AcuI CTGAAG 1 cut(s) 299
AfaI GTAC 1 cut(s) 85
AfiI CCNNNNNNNGG 1 cut(s) 187
AhlI ACTAGT 1 cut(s) 166
AluBI AGCT 3 cut(s) 134, 230, 328
AluI AGCT 3 cut(s) 134, 230, 328
AlwI GGATC 2 cut(s) 128, 172
AlwNI CAGNNNCTG 1 cut(s) 38
AspS9I GGNCC 1 cut(s) 207
AsuHPI GGTGA 1 cut(s) 257
AvaII GGWCC 1 cut(s) 207
BbsI GAAGAC 1 cut(s) 280
BccI CCATC 1 cut(s) 179
BcuI ACTAGT 1 cut(s) 166
BfaI CTAG 2 cut(s) 135, 167
BfmI CTRYAG 1 cut(s) 129
BmcAI AGTACT 1 cut(s) 85
Bme18I GGWCC 1 cut(s) 207
BmgT120I GGNCC 1 cut(s) 207
BmiI GGNNCC 1 cut(s) 209
BmrI ACTGGG 1 cut(s) 206
BmsI GCATC 2 cut(s) 115, 119
BmuI ACTGGG 1 cut(s) 206
BpiI GAAGAC 1 cut(s) 280
BplI GAGNNNNNCTC 2 cut(s) 219, 251
BpuEI CTTGAG 1 cut(s) 221
Bsa29I ATCGAT 1 cut(s) 123
Bsc4I CCNNNNNNNGG 1 cut(s) 187
Bse1I ACTGG 3 cut(s) 32, 209, 212
Bse3DI GCAATG 1 cut(s) 31
BseCI ATCGAT 1 cut(s) 123
BseGI GGATG 1 cut(s) 196
BseLI CCNNNNNNNGG 1 cut(s) 187
BseMI GCAATG 1 cut(s) 31
BseNI ACTGG 3 cut(s) 32, 209, 212
BsgI GTGCAG 1 cut(s) 159
BshVI ATCGAT 1 cut(s) 123
BslI CCNNNNNNNGG 1 cut(s) 187
Bsp143I GATC 3 cut(s) 57, 120, 177
BspDI ATCGAT 1 cut(s) 123
BspLI GGNNCC 1 cut(s) 209
BspPI GGATC 2 cut(s) 128, 172
BsrDI GCAATG 1 cut(s) 31
BsrI ACTGG 3 cut(s) 32, 209, 212
BssMI GATC 3 cut(s) 57, 120, 177
Bst4CI ACNGT 1 cut(s) 159
BstDEI CTNAG 1 cut(s) 87
BstF5I GGATG 1 cut(s) 196
BstKTI GATC 3 cut(s) 60, 123, 180
BstMBI GATC 3 cut(s) 57, 120, 177
BstSFI CTRYAG 1 cut(s) 129
BstV2I GAAGAC 1 cut(s) 280
Bsu15I ATCGAT 1 cut(s) 123
BsuTUI ATCGAT 1 cut(s) 123
BtsCI GGATG 1 cut(s) 196
CaiI CAGNNNCTG 1 cut(s) 38
Cfr13I GGNCC 1 cut(s) 207
ClaI ATCGAT 1 cut(s) 123
Csp6I GTAC 1 cut(s) 84
CviJI RGCY 4 cut(s) 134, 230, 242, 328
CviKI_1 RGCY 4 cut(s) 134, 230, 242, 328
CviQI GTAC 1 cut(s) 84
DdeI CTNAG 1 cut(s) 87
DpnI GATC 3 cut(s) 59, 122, 179
DpnII GATC 3 cut(s) 57, 120, 177
DraI TTTAAA 1 cut(s) 97
Eco47I GGWCC 1 cut(s) 207
Eco57I CTGAAG 1 cut(s) 299
FaiI YATR 2 cut(s) 104, 131
FokI GGATG 1 cut(s) 203
FspBI CTAG 2 cut(s) 135, 167
HincII GTYRAC 1 cut(s) 172
HindII GTYRAC 1 cut(s) 172
HphI GGTGA 1 cut(s) 257
Hpy166II GTNNAC 1 cut(s) 172
Hpy8I GTNNAC 1 cut(s) 172
HpyAV CCTTC 1 cut(s) 301
HpyCH4III ACNGT 1 cut(s) 159
HpyCH4V TGCA 2 cut(s) 140, 320
HpyF3I CTNAG 1 cut(s) 87
Kzo9I GATC 3 cut(s) 57, 120, 177
LmnI GCTCC 1 cut(s) 227
LpnPI CCDG 6 cut(s) 45, 126, 188, 190, 225, 228
LweI GCATC 2 cut(s) 115, 119
MaeI CTAG 2 cut(s) 135, 167
MaeIII GTNAC 2 cut(s) 40, 214
MalI GATC 3 cut(s) 59, 122, 179
MboI GATC 3 cut(s) 57, 120, 177
MboII GAAGA 2 cut(s) 285, 292
MluCI AATT 1 cut(s) 291
MnlI CCTC 3 cut(s) 111, 209, 257
MseI TTAA 3 cut(s) 96, 147, 294
NdeII GATC 3 cut(s) 57, 120, 177
NlaIV GGNNCC 1 cut(s) 209
PspN4I GGNNCC 1 cut(s) 209
PspPI GGNCC 1 cut(s) 207
PstNI CAGNNNCTG 1 cut(s) 38
RsaI GTAC 1 cut(s) 85
RsaNI GTAC 1 cut(s) 84
SaqAI TTAA 3 cut(s) 96, 147, 294
Sau3AI GATC 3 cut(s) 57, 120, 177
Sau96I GGNCC 1 cut(s) 207
ScaI AGTACT 1 cut(s) 85
SetI ASST 5 cut(s) 21, 136, 177, 232, 330
SfaNI GCATC 2 cut(s) 115, 119
SfcI CTRYAG 1 cut(s) 129
SinI GGWCC 1 cut(s) 207
SmlI CTYRAG 1 cut(s) 236
SmoI CTYRAG 1 cut(s) 236
SpeI ACTAGT 1 cut(s) 166
Sse9I AATT 1 cut(s) 291
SspMI CTAG 2 cut(s) 135, 167
TaaI ACNGT 1 cut(s) 159
TaqI TCGA 3 cut(s) 12, 123, 262
TasI AATT 1 cut(s) 291
TatI WGTACW 1 cut(s) 83
Tru1I TTAA 3 cut(s) 96, 147, 294
Tru9I TTAA 3 cut(s) 96, 147, 294
TspGWI ACGGA 1 cut(s) 170
VpaK11BI GGWCC 1 cut(s) 207
XspI CTAG 2 cut(s) 135, 167
ZrmI AGTACT 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.