Rmu_sc0009986.1_g000011

disease resistance protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009986.1
Physical Location & Seq
Reverse (-)
49644 .. 50237
594 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009986.1_g000011.1.cds

Sequence Viewer

Length: 594 bp
atgggaggattggggaagacaactttcacccaattagtctttaaggatgcacaagttcaagcccattttgatatcaaagcttgggtttgtgtctcagaccctttcgatatcatcaagattgcaaaggaaatccttgaacttgtcagtggaataaaatctcaagatagttcaaatgtgttgcaaaaattgttagaaagcatccaagaaagaataaacggcaacaattttctcctcgtgctagatgatgtgtggacagaagaccaaacaaagtgggagagtttaaggttaccagtactaatgcaaacctgttctgaaggcagtagaattctggtgaccactcgaaagcaggaggttgctcgaatgatgagagcaaccagggacatgatcactttggagaagttaagtcatttagattctttggaactattctataatgttgcatctctggatagggaacaagataagtccaacaaggggtttggagatattgctgagaaaattgttagaaaatgtgacggtttgcctctcgttatgaagactttaggtggtctgtcgttgcataagcaaacaattagagaatgggaagaagtttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

197

Amino Acids

22.43

Weight (kDa)

5.71

Isoelectric Point (pI)

32.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021678)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0009986.1_g000011
rosa_rugosa Rorug07G0254200 Rorug07G0254700 Rorug07G0268500
rosa_samantha Rh7BG385500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 324
AcuI CTGAAG 1 cut(s) 333
AfaI GTAC 1 cut(s) 294
AfiI CCNNNNNNNGG 1 cut(s) 474
AgsI TTSAA 3 cut(s) 59, 137, 171
AjnI CCWGG 1 cut(s) 374
AluBI AGCT 1 cut(s) 80
AluI AGCT 1 cut(s) 80
Alw26I GTCTC 1 cut(s) 97
ApoI RAATTY 1 cut(s) 324
AsuHPI GGTGA 2 cut(s) 19, 343
BauI CACGAG 1 cut(s) 233
BbsI GAAGAC 3 cut(s) 23, 264, 542
BceAI ACGGC 1 cut(s) 232
BciT130I CCWGG 1 cut(s) 376
BclI TGATCA 1 cut(s) 384
BcoDI GTCTC 1 cut(s) 97
BfaI CTAG 1 cut(s) 239
BmcAI AGTACT 1 cut(s) 294
Bme1390I CCNGG 1 cut(s) 376
BmrFI CCNGG 1 cut(s) 376
BmsI GCATC 3 cut(s) 37, 207, 449
BpiI GAAGAC 3 cut(s) 23, 264, 542
BpuEI CTTGAG 1 cut(s) 144
BsaJI CCNNGG 1 cut(s) 375
Bsc4I CCNNNNNNNGG 1 cut(s) 474
Bse1I ACTGG 1 cut(s) 290
BseBI CCWGG 1 cut(s) 376
BseDI CCNNGG 1 cut(s) 375
BseGI GGATG 2 cut(s) 52, 198
BseLI CCNNNNNNNGG 1 cut(s) 474
BseMII CTCAG 2 cut(s) 108, 483
BseNI ACTGG 1 cut(s) 290
BseRI GAGGAG 1 cut(s) 221
BslFI GGGAC 1 cut(s) 392
BslI CCNNNNNNNGG 1 cut(s) 474
BsmAI GTCTC 1 cut(s) 97
BsmFI GGGAC 1 cut(s) 392
Bsp143I GATC 1 cut(s) 384
BspCNI CTCAG 2 cut(s) 107, 484
BsrI ACTGG 1 cut(s) 290
BssECI CCNNGG 1 cut(s) 375
BssMI GATC 1 cut(s) 384
BssSI CACGAG 1 cut(s) 233
Bst2BI CACGAG 1 cut(s) 233
Bst2UI CCWGG 1 cut(s) 376
Bst4CI ACNGT 1 cut(s) 518
BstDEI CTNAG 2 cut(s) 94, 492
BstEII GGTNACC 2 cut(s) 285, 331
BstF5I GGATG 2 cut(s) 52, 198
BstKTI GATC 1 cut(s) 387
BstMAI GTCTC 1 cut(s) 97
BstMBI GATC 1 cut(s) 384
BstNI CCWGG 1 cut(s) 376
BstPI GGTNACC 2 cut(s) 285, 331
BstSCI CCNGG 1 cut(s) 374
BstV2I GAAGAC 3 cut(s) 23, 264, 542
BtsCI GGATG 2 cut(s) 52, 198
BtsIMutI CAGTG 1 cut(s) 151
Csp6I GTAC 1 cut(s) 293
CspCI CAANNNNNGTGG 2 cut(s) 251, 286
CviAII CATG 1 cut(s) 382
CviJI RGCY 2 cut(s) 62, 80
CviKI_1 RGCY 2 cut(s) 62, 80
CviQI GTAC 1 cut(s) 293
DdeI CTNAG 2 cut(s) 94, 492
DpnI GATC 1 cut(s) 386
DpnII GATC 1 cut(s) 384
Eco32I GATATC 2 cut(s) 73, 109
Eco57I CTGAAG 1 cut(s) 333
Eco91I GGTNACC 2 cut(s) 285, 331
EcoO65I GGTNACC 2 cut(s) 285, 331
EcoRI GAATTC 1 cut(s) 324
EcoRII CCWGG 1 cut(s) 374
EcoRV GATATC 2 cut(s) 73, 109
FaeI CATG 1 cut(s) 385
FaiI YATR 4 cut(s) 383, 432, 533, 561
FaqI GGGAC 1 cut(s) 392
FatI CATG 1 cut(s) 381
FbaI TGATCA 1 cut(s) 384
FokI GGATG 2 cut(s) 59, 185
FspBI CTAG 1 cut(s) 239
Hin1II CATG 1 cut(s) 385
HindIII AAGCTT 1 cut(s) 78
HinfI GANTC 1 cut(s) 413
HphI GGTGA 2 cut(s) 19, 343
Hpy166II GTNNAC 1 cut(s) 252
Hpy188I TCNGA 2 cut(s) 97, 313
Hpy188III TCNNGA 3 cut(s) 115, 161, 446
Hpy8I GTNNAC 1 cut(s) 252
HpyAV CCTTC 1 cut(s) 308
HpyCH4III ACNGT 1 cut(s) 518
HpyCH4V TGCA 6 cut(s) 50, 122, 181, 301, 440, 559
HpyF3I CTNAG 2 cut(s) 94, 492
Hsp92II CATG 1 cut(s) 385
Ksp22I TGATCA 1 cut(s) 384
Kzo9I GATC 1 cut(s) 384
LpnPI CCDG 7 cut(s) 303, 314, 319, 332, 361, 388, 431
LweI GCATC 3 cut(s) 37, 207, 449
MaeI CTAG 1 cut(s) 239
MaeIII GTNAC 3 cut(s) 285, 331, 512
MalI GATC 1 cut(s) 386
MboI GATC 1 cut(s) 384
MboII GAAGA 3 cut(s) 28, 269, 547
MluCI AATT 6 cut(s) 32, 185, 223, 324, 498, 570
MmeI TCCRAC 1 cut(s) 492
MnlI CCTC 3 cut(s) 242, 343, 534
MseI TTAA 3 cut(s) 42, 281, 401
MspR9I CCNGG 1 cut(s) 376
MvaI CCWGG 1 cut(s) 376
NdeII GATC 1 cut(s) 384
NlaIII CATG 1 cut(s) 385
NmuCI GTSAC 2 cut(s) 331, 512
PfeI GAWTC 1 cut(s) 413
Psp6I CCWGG 1 cut(s) 374
PspEI GGTNACC 2 cut(s) 285, 331
PspGI CCWGG 1 cut(s) 374
RsaI GTAC 1 cut(s) 294
RsaNI GTAC 1 cut(s) 293
SaqAI TTAA 3 cut(s) 42, 281, 401
Sau3AI GATC 1 cut(s) 384
ScaI AGTACT 1 cut(s) 294
ScrFI CCNGG 1 cut(s) 376
SetI ASST 5 cut(s) 82, 287, 308, 354, 547
SfaNI GCATC 3 cut(s) 37, 207, 449
SmlI CTYRAG 1 cut(s) 159
SmoI CTYRAG 1 cut(s) 159
Sse9I AATT 6 cut(s) 32, 185, 223, 324, 498, 570
SspMI CTAG 1 cut(s) 239
StyD4I CCNGG 1 cut(s) 374
TaaI ACNGT 1 cut(s) 518
TaqI TCGA 3 cut(s) 105, 340, 358
TasI AATT 6 cut(s) 32, 185, 223, 324, 498, 570
TatI WGTACW 1 cut(s) 292
TfiI GAWTC 1 cut(s) 413
Tru1I TTAA 3 cut(s) 42, 281, 401
Tru9I TTAA 3 cut(s) 42, 281, 401
TscAI CASTG 1 cut(s) 151
TseFI GTSAC 2 cut(s) 331, 512
Tsp45I GTSAC 2 cut(s) 331, 512
TspDTI ATGAA 1 cut(s) 548
TspRI CASTG 1 cut(s) 151
XapI RAATTY 1 cut(s) 324
XspI CTAG 1 cut(s) 239
ZrmI AGTACT 1 cut(s) 294
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.