Rh7BG385500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
41710304 .. 41711866
1563 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG385500.1

Sequence Viewer

Length: 156 bp
ATGGAGGCTATGGATACCAATGGAATAGAGCCATCGAATGCTGAAATACTGAAACGACCAGAATCAAATCTTACAAAGATTTATGTACAGGTAGCTTTAAGCATAATTGAAGTTGTCCAACTGATTGATGAGATTCTGCAAATAGAACAAAGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.8

Weight (kDa)

4.29

Isoelectric Point (pI)

70.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021678)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0009986.1_g000011
rosa_rugosa Rorug07G0254200 Rorug07G0254700 Rorug07G0268500
rosa_samantha Rh7BG385500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 87
AgsI TTSAA 1 cut(s) 110
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
BccI CCATC 1 cut(s) 40
BciVI GTATCC 1 cut(s) 7
BfuI GTATCC 1 cut(s) 7
BsmI GAATGC 1 cut(s) 43
Bsp1407I TGTACA 1 cut(s) 85
BsrGI TGTACA 1 cut(s) 85
BstAUI TGTACA 1 cut(s) 85
BsuI GTATCC 1 cut(s) 7
Csp6I GTAC 1 cut(s) 86
CviJI RGCY 3 cut(s) 8, 31, 95
CviKI_1 RGCY 3 cut(s) 8, 31, 95
CviQI GTAC 1 cut(s) 86
FaiI YATR 3 cut(s) 11, 84, 104
FspEI CC 7 cut(s) 6, 31, 45, 72, 74, 131, 136
HinfI GANTC 2 cut(s) 62, 133
HpyCH4V TGCA 1 cut(s) 139
LpnPI CCDG 2 cut(s) 72, 74
MluCI AATT 1 cut(s) 105
MmeI TCCRAC 1 cut(s) 142
MseI TTAA 1 cut(s) 98
Mva1269I GAATGC 1 cut(s) 43
PctI GAATGC 1 cut(s) 43
PfeI GAWTC 2 cut(s) 62, 133
RsaI GTAC 1 cut(s) 87
RsaNI GTAC 1 cut(s) 86
SaqAI TTAA 1 cut(s) 98
SetI ASST 3 cut(s) 93, 97, 155
SgeI CNNG 2 cut(s) 71, 101
Sse9I AATT 1 cut(s) 105
TaqI TCGA 1 cut(s) 35
TasI AATT 1 cut(s) 105
TatI WGTACW 1 cut(s) 85
TfiI GAWTC 2 cut(s) 62, 133
Tru1I TTAA 1 cut(s) 98
Tru9I TTAA 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.