Rmu_sc0011280.1_g000004

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011280.1
Physical Location & Seq
Forward (+)
9631 .. 9935
305 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011280.1_g000004.1.cds

Sequence Viewer

Length: 213 bp
atgagaccaagaactgtgactgctaatacaacagctccaagtgttccacataatgaatcgacaatgtcccttaggttaagcagtcgccagattacccttctgctttcatttatctgggcacactccatctcccctttaaatacgcctgaaaactatcaagcaattgctcatacctacagccttgtgttgctatatgctcggactaaggtataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.87

Weight (kDa)

10.41

Isoelectric Point (pI)

43.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018115)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
AxyI CCTNAGG 1 cut(s) 71
BaeGI GKGCMC 1 cut(s) 121
BccI CCATC 1 cut(s) 134
BfmI CTRYAG 1 cut(s) 175
BsaXI ACNNNNNCTCC 4 cut(s) 19, 49, 113, 143
Bse21I CCTNAGG 1 cut(s) 71
BseSI GKGCMC 1 cut(s) 121
BslFI GGGAC 1 cut(s) 52
BsmFI GGGAC 1 cut(s) 52
Bsp1286I GDGCHC 1 cut(s) 121
Bst4CI ACNGT 1 cut(s) 16
BstDEI CTNAG 2 cut(s) 71, 204
BstSFI CTRYAG 1 cut(s) 175
BstSLI GKGCMC 1 cut(s) 121
Bsu36I CCTNAGG 1 cut(s) 71
CviJI RGCY 2 cut(s) 35, 180
CviKI_1 RGCY 2 cut(s) 35, 180
DdeI CTNAG 2 cut(s) 71, 204
DraI TTTAAA 1 cut(s) 138
Eco81I CCTNAGG 1 cut(s) 71
FaiI YATR 5 cut(s) 51, 171, 193, 195, 211
FaqI GGGAC 1 cut(s) 52
HinfI GANTC 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 201
HpyAV CCTTC 1 cut(s) 107
HpyCH4III ACNGT 1 cut(s) 16
HpyF3I CTNAG 2 cut(s) 71, 204
LmnI GCTCC 1 cut(s) 40
LpnPI CCDG 3 cut(s) 100, 101, 159
MaeIII GTNAC 1 cut(s) 16
MfeI CAATTG 1 cut(s) 162
MhlI GDGCHC 1 cut(s) 121
MluCI AATT 1 cut(s) 162
MseI TTAA 2 cut(s) 77, 137
MunI CAATTG 1 cut(s) 162
NmuCI GTSAC 1 cut(s) 16
PfeI GAWTC 1 cut(s) 56
PflFI GACNNNGTC 1 cut(s) 64
PsyI GACNNNGTC 1 cut(s) 64
SaqAI TTAA 2 cut(s) 77, 137
SduI GDGCHC 1 cut(s) 121
SetI ASST 4 cut(s) 37, 77, 176, 210
SfcI CTRYAG 1 cut(s) 175
SgeI CNNG 7 cut(s) 21, 51, 100, 127, 158, 170, 194
Sse9I AATT 1 cut(s) 162
TaaI ACNGT 1 cut(s) 16
TaqI TCGA 1 cut(s) 59
TasI AATT 1 cut(s) 162
TfiI GAWTC 1 cut(s) 56
Tru1I TTAA 2 cut(s) 77, 137
Tru9I TTAA 2 cut(s) 77, 137
TseFI GTSAC 1 cut(s) 16
Tsp45I GTSAC 1 cut(s) 16
TspDTI ATGAA 2 cut(s) 69, 96
Tth111I GACNNNGTC 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.