Rh6CG160700

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Reverse (-)
21072091 .. 21073062
972 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG160700.1

Sequence Viewer

Length: 219 bp
ATGAGACCAAGAACTGTGACTGCTGATACAACAGCTCCAAGTGTTCCACATAATGAATCGACAATGTCCCTTAGGTTAAGCAGTCGCCAGATTACCCTTCTGCTTTCATTTATCTGGGCACACTCCATCTCCCCTTTAAATACGCCTGAAAACTATCAAGCAATTGCTCATACCTACAGCCTTGTGTTGCTATATGCTCAGACTAAGGAATGGTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.22

Weight (kDa)

8.2

Isoelectric Point (pI)

39.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018115)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 215
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
AxyI CCTNAGG 1 cut(s) 71
BaeGI GKGCMC 1 cut(s) 121
BccI CCATC 1 cut(s) 134
BfaI CTAG 1 cut(s) 217
BfmI CTRYAG 1 cut(s) 175
BsaXI ACNNNNNCTCC 4 cut(s) 19, 49, 113, 143
Bse21I CCTNAGG 1 cut(s) 71
BseMII CTCAG 1 cut(s) 212
BseSI GKGCMC 1 cut(s) 121
BslFI GGGAC 1 cut(s) 52
BsmFI GGGAC 1 cut(s) 52
Bsp1286I GDGCHC 1 cut(s) 121
BspCNI CTCAG 1 cut(s) 211
Bst4CI ACNGT 1 cut(s) 16
BstDEI CTNAG 3 cut(s) 71, 198, 204
BstSFI CTRYAG 1 cut(s) 175
BstSLI GKGCMC 1 cut(s) 121
Bsu36I CCTNAGG 1 cut(s) 71
Csp6I GTAC 1 cut(s) 214
CviJI RGCY 2 cut(s) 35, 180
CviKI_1 RGCY 2 cut(s) 35, 180
CviQI GTAC 1 cut(s) 214
DdeI CTNAG 3 cut(s) 71, 198, 204
DraI TTTAAA 1 cut(s) 138
Eco81I CCTNAGG 1 cut(s) 71
FaiI YATR 4 cut(s) 51, 171, 193, 195
FaqI GGGAC 1 cut(s) 52
FspBI CTAG 1 cut(s) 217
HinfI GANTC 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 201
HpyAV CCTTC 1 cut(s) 107
HpyCH4III ACNGT 1 cut(s) 16
HpyF3I CTNAG 3 cut(s) 71, 198, 204
LmnI GCTCC 1 cut(s) 40
LpnPI CCDG 3 cut(s) 100, 101, 159
MaeI CTAG 1 cut(s) 217
MaeIII GTNAC 1 cut(s) 16
MfeI CAATTG 1 cut(s) 162
MhlI GDGCHC 1 cut(s) 121
MluCI AATT 1 cut(s) 162
MseI TTAA 2 cut(s) 77, 137
MunI CAATTG 1 cut(s) 162
NmuCI GTSAC 1 cut(s) 16
PfeI GAWTC 1 cut(s) 56
PflFI GACNNNGTC 1 cut(s) 64
PsyI GACNNNGTC 1 cut(s) 64
RsaI GTAC 1 cut(s) 215
RsaNI GTAC 1 cut(s) 214
SaqAI TTAA 2 cut(s) 77, 137
SduI GDGCHC 1 cut(s) 121
SetI ASST 3 cut(s) 37, 77, 176
SfcI CTRYAG 1 cut(s) 175
SgeI CNNG 7 cut(s) 21, 51, 100, 127, 158, 170, 194
Sse9I AATT 1 cut(s) 162
SspMI CTAG 1 cut(s) 217
TaaI ACNGT 1 cut(s) 16
TaqI TCGA 1 cut(s) 59
TasI AATT 1 cut(s) 162
TfiI GAWTC 1 cut(s) 56
Tru1I TTAA 2 cut(s) 77, 137
Tru9I TTAA 2 cut(s) 77, 137
TseFI GTSAC 1 cut(s) 16
Tsp45I GTSAC 1 cut(s) 16
TspDTI ATGAA 2 cut(s) 69, 96
Tth111I GACNNNGTC 1 cut(s) 64
XspI CTAG 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.