Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011963.1

Orthogroup ID

OG0019130

Physical Location & Seq

Genomic Coordinates Reverse (-)

43017 .. 45055

Gene Structure 2039 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011963.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1137 bp

atgatgcagatatgtgaccaattttcagctcaactgtttgaaattgactcgcagcctagaaaggttcctgttctgtgcaacatcacaagttcaatgaaatcacaccagtcgaaagttggagattgcagggacttctgcacaaagttgtgggataaatgtggcaacatatccttattgagttctccatttgctccatcctctcaaggcagaatgactgatcattggcagtcgaaacaagacttctgtgaagcatttggtggatcagaagatgccgtgtgtttcaatggtgtatcggtttcatttagtcaagttgatgctccgcctcctccagctggtctgtgccttgagaaaattggaaatgggacttatatcaatctagttccacatccagatggttccaaccgcgcatttgtgtctaacaaacaaggccagatatggttggcaactgttcctgatgaaggatcaagtgggattttgggaatcaatgaagctgaaccttttttggacattactgatcaagtgctctttggcaccgagtttggtcaaatgaatgtgaattgtgacccttcaaagctttctgctgatagtggggtgcagccctgtcaataccacagtgttgttgctgaatttacagttaatggtacagcaccggagccttccttggcaaaaagctcaaatccatcagaagtgagaaggatattcacaatggggcttccttataggggagatcacgccggtcagattctttttggacctgcagatggttatctatacctcatgatgggagatggttcgcatcgggatgacccttacaattttgcacagaacaagaagtccttgcttaggaaaattatgagtctagacatagataacataccaagcactgaaaaccccgaaaacagtggtaacttctcgactaccaagatttcattcagatgtgctcatgactctccaatgcaatgtaacattgtggcaggaagttctacaccttccctggggtatgtcttctcatttggcgaagataacaagaaggatgtttatgtattgacaagcactggtgtctatagagtcacaagaccaagccactgcaattttacatgtgctaaagaacatgtagtcgatttggggactcattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

GSDH

Protein Analysis

378

Amino Acids

41.19

Weight (kDa)

5.25

Isoelectric Point (pI)

40.86

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019130)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g15830
prunus_persica	Prupe.5G184100_v2.0.a1
rosa_chinensis	RchiOBHm_Chr7g0180301
rosa_multiflora	Rmu_co8475727.1_g000001 Rmu_sc0011963.1_g000016
rosa_samantha	Rh7AG032400 Rh7CG034200 Rh7DG032900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	763
AccB1I	GGYRCC	1 cut(s)	530
AccII	CGCG	1 cut(s)	405
AciI	CCGC	2 cut(s)	320, 403
AclWI	GGATC	2 cut(s)	268, 469
AcsI	RAATTY	1 cut(s)	626
AfaI	GTAC	1 cut(s)	643
AfiI	CCNNNNNNNGG	7 cut(s)	332, 458, 722, 761, 781, 843, 995
AflIII	ACRYGT	2 cut(s)	1097, 1111
AgsI	TTSAA	4 cut(s)	41, 93, 283, 570
AjnI	CCWGG	1 cut(s)	993
AjuI	GAANNNNNNNTTGG	2 cut(s)	914, 946
AloI	GAACNNNNNNTCC	2 cut(s)	818, 850
AluBI	AGCT	5 cut(s)	29, 332, 491, 574, 672
AluI	AGCT	5 cut(s)	29, 332, 491, 574, 672
Alw21I	GWGCWC	2 cut(s)	525, 943
AlwI	GGATC	2 cut(s)	268, 469
AoxI	GGCC	1 cut(s)	427
ApeKI	GCWGC	2 cut(s)	52, 595
ApoI	RAATTY	1 cut(s)	626
AspLEI	GCGC	1 cut(s)	407
AspS9I	GGNCC	1 cut(s)	752
AvaII	GGWCC	1 cut(s)	752
BanI	GGYRCC	1 cut(s)	530
BbsI	GAAGAC	1 cut(s)	997
Bbv12I	GWGCWC	2 cut(s)	525, 943
BbvI	GCAGC	2 cut(s)	64, 607
BccI	CCATC	6 cut(s)	202, 386, 688, 755, 775, 782
BceAI	ACGGC	1 cut(s)	257
BciT130I	CCWGG	1 cut(s)	995
BclI	TGATCA	2 cut(s)	217, 514
BfaI	CTAG	3 cut(s)	57, 377, 860
BfmI	CTRYAG	2 cut(s)	756, 1063
BfuAI	ACCTGC	1 cut(s)	763
BisI	GCNGC	2 cut(s)	53, 596
BlsI	GCNGC	2 cut(s)	54, 597
Bme1390I	CCNGG	1 cut(s)	995
Bme18I	GGWCC	1 cut(s)	752
BmgT120I	GGNCC	1 cut(s)	752
BmiI	GGNNCC	4 cut(s)	66, 397, 532, 654
BmrFI	CCNGG	1 cut(s)	995
BmsI	GCATC	3 cut(s)	259, 304, 805
BpiI	GAAGAC	1 cut(s)	997
BpmI	CTGGAG	1 cut(s)	312
Bpu10I	CCTNAGC	1 cut(s)	842
BpuEI	CTTGAG	2 cut(s)	186, 365
BsaBI	GATNNNNATC	1 cut(s)	765
BsaJI	CCNNGG	3 cut(s)	660, 993, 994
BsaWI	WCCGGW	1 cut(s)	649
Bsc4I	CCNNNNNNNGG	7 cut(s)	332, 458, 722, 761, 781, 843, 995
Bse118I	RCCGGY	1 cut(s)	734
Bse1I	ACTGG	2 cut(s)	106, 1060
Bse3DI	GCAATG	1 cut(s)	965
Bse8I	GATNNNNATC	1 cut(s)	765
BseBI	CCWGG	1 cut(s)	995
BseDI	CCNNGG	3 cut(s)	660, 993, 994
BseGI	GGATG	4 cut(s)	194, 385, 808, 1039
BseJI	GATNNNNATC	1 cut(s)	765
BseLI	CCNNNNNNNGG	7 cut(s)	332, 458, 722, 761, 781, 843, 995
BseMI	GCAATG	1 cut(s)	965
BseNI	ACTGG	2 cut(s)	106, 1060
BseRI	GAGGAG	1 cut(s)	315
BseXI	GCAGC	2 cut(s)	64, 607
BsgI	GTGCAG	2 cut(s)	121, 614
Bsh1236I	CGCG	1 cut(s)	405
BshFI	GGCC	1 cut(s)	429
BshNI	GGYRCC	1 cut(s)	530
BsiHKAI	GWGCWC	2 cut(s)	525, 943
BsiSI	CCGG	2 cut(s)	650, 735
BslFI	GGGAC	2 cut(s)	143, 376
BslI	CCNNNNNNNGG	7 cut(s)	332, 458, 722, 761, 781, 843, 995
BsmFI	GGGAC	2 cut(s)	143, 376
BsnI	GGCC	1 cut(s)	429
Bsp1286I	GDGCHC	2 cut(s)	525, 943
Bsp143I	GATC	5 cut(s)	217, 260, 461, 514, 727
BspACI	CCGC	2 cut(s)	320, 403
BspANI	GGCC	1 cut(s)	429
BspFNI	CGCG	1 cut(s)	405
BspHI	TCATGA	2 cut(s)	777, 943
BspLI	GGNNCC	4 cut(s)	66, 397, 532, 654
BspMAI	CTGCAG	1 cut(s)	760
BspMI	ACCTGC	1 cut(s)	763
BspPI	GGATC	2 cut(s)	268, 469
BspT107I	GGYRCC	1 cut(s)	530
BsrDI	GCAATG	1 cut(s)	965
BsrFI	RCCGGY	1 cut(s)	734
BsrI	ACTGG	2 cut(s)	106, 1060
BssAI	RCCGGY	1 cut(s)	734
BssECI	CCNNGG	3 cut(s)	660, 993, 994
BssMI	GATC	5 cut(s)	217, 260, 461, 514, 727
BssT1I	CCWWGG	1 cut(s)	660
Bst2UI	CCWGG	1 cut(s)	995
Bst4CI	ACNGT	5 cut(s)	36, 448, 614, 634, 902
BstDEI	CTNAG	1 cut(s)	842
BstENI	CCTNNNNNAGG	2 cut(s)	456, 841
BstF5I	GGATG	4 cut(s)	194, 385, 808, 1039
BstFNI	CGCG	1 cut(s)	405
BstHHI	GCGC	1 cut(s)	407
BstKTI	GATC	5 cut(s)	220, 263, 464, 517, 730
BstMBI	GATC	5 cut(s)	217, 260, 461, 514, 727
BstNI	CCWGG	1 cut(s)	995
BstNSI	RCATGY	2 cut(s)	1101, 1115
BstSCI	CCNGG	1 cut(s)	993
BstSFI	CTRYAG	2 cut(s)	756, 1063
BstUI	CGCG	1 cut(s)	405
BstV1I	GCAGC	2 cut(s)	64, 607
BstV2I	GAAGAC	1 cut(s)	997
BsuRI	GGCC	1 cut(s)	429
BtsCI	GGATG	4 cut(s)	194, 385, 808, 1039
BtsI	GCAGTG	1 cut(s)	1084
BtsIMutI	CAGTG	5 cut(s)	619, 882, 907, 1053, 1084
BveI	ACCTGC	1 cut(s)	763
CciI	TCATGA	2 cut(s)	777, 943
CfoI	GCGC	1 cut(s)	407
Cfr10I	RCCGGY	1 cut(s)	734
Cfr13I	GGNCC	1 cut(s)	752
Csp6I	GTAC	1 cut(s)	642
CviAII	CATG	4 cut(s)	778, 944, 1098, 1112
CviQI	GTAC	1 cut(s)	642
DdeI	CTNAG	1 cut(s)	842
DpnI	GATC	5 cut(s)	219, 262, 463, 516, 729
DpnII	GATC	5 cut(s)	217, 260, 461, 514, 727
EciI	GGCGGA	1 cut(s)	309
Eco130I	CCWWGG	1 cut(s)	660
Eco47I	GGWCC	1 cut(s)	752
EcoNI	CCTNNNNNAGG	2 cut(s)	456, 841
EcoRII	CCWGG	1 cut(s)	993
EcoT14I	CCWWGG	1 cut(s)	660
ErhI	CCWWGG	1 cut(s)	660
FaeI	CATG	4 cut(s)	781, 947, 1101, 1115
FalI	AAGNNNNNCTT	2 cut(s)	821, 853
FaqI	GGGAC	2 cut(s)	143, 376
FatI	CATG	4 cut(s)	777, 943, 1097, 1111
FbaI	TGATCA	2 cut(s)	217, 514
Fnu4HI	GCNGC	2 cut(s)	53, 596
FokI	GGATG	4 cut(s)	181, 372, 815, 1046
Fsp4HI	GCNGC	2 cut(s)	53, 596
FspBI	CTAG	3 cut(s)	57, 377, 860
GlaI	GCGC	1 cut(s)	406
GluI	GCNGC	2 cut(s)	53, 596
GsuI	CTGGAG	1 cut(s)	312
HaeIII	GGCC	1 cut(s)	429
HapII	CCGG	2 cut(s)	650, 735
HhaI	GCGC	1 cut(s)	407
Hin1II	CATG	4 cut(s)	781, 947, 1101, 1115
Hin6I	GCGC	1 cut(s)	405
HinP1I	GCGC	1 cut(s)	405
HindIII	AAGCTT	1 cut(s)	572
HinfI	GANTC	7 cut(s)	47, 480, 742, 856, 947, 1068, 1129
HpaII	CCGG	2 cut(s)	650, 735
Hpy188I	TCNGA	4 cut(s)	265, 685, 741, 935
Hpy188III	TCNNGA	7 cut(s)	389, 452, 778, 800, 860, 913, 944
HpyAV	CCTTC	6 cut(s)	452, 576, 666, 687, 999, 1024
HpyCH4III	ACNGT	5 cut(s)	36, 448, 614, 634, 902
HpyCH4V	TGCA	9 cut(s)	7, 78, 126, 138, 595, 758, 821, 958, 1089
HpyF3I	CTNAG	1 cut(s)	842
Hsp92II	CATG	4 cut(s)	781, 947, 1101, 1115
HspAI	GCGC	1 cut(s)	405
Ksp22I	TGATCA	2 cut(s)	217, 514
Kzo9I	GATC	5 cut(s)	217, 260, 461, 514, 727
LmnI	GCTCC	3 cut(s)	196, 322, 652
Lsp1109I	GCAGC	2 cut(s)	64, 607
LweI	GCATC	3 cut(s)	259, 304, 805
MaeI	CTAG	3 cut(s)	57, 377, 860
MaeIII	GTNAC	5 cut(s)	14, 560, 905, 962, 1069
MalI	GATC	5 cut(s)	219, 262, 463, 516, 729
MboI	GATC	5 cut(s)	217, 260, 461, 514, 727
MboII	GAAGA	3 cut(s)	278, 997, 1031
MhlI	GDGCHC	2 cut(s)	525, 943
MluCI	AATT	8 cut(s)	20, 42, 351, 556, 626, 814, 849, 1090
MlyI	GAGTC	5 cut(s)	41, 865, 941, 1077, 1123
MmeI	TCCRAC	2 cut(s)	97, 423
MnlI	CCTC	4 cut(s)	208, 333, 336, 785
MseI	TTAA	1 cut(s)	636
MslI	CAYNNNNRTG	3 cut(s)	390, 801, 934
MspA1I	CMGCKG	1 cut(s)	332
MspI	CCGG	2 cut(s)	650, 735
MspR9I	CCNGG	1 cut(s)	995
MvaI	CCWGG	1 cut(s)	995
MvnI	CGCG	1 cut(s)	405
NdeII	GATC	5 cut(s)	217, 260, 461, 514, 727
NlaIII	CATG	4 cut(s)	781, 947, 1101, 1115
NlaIV	GGNNCC	4 cut(s)	66, 397, 532, 654
NmuCI	GTSAC	3 cut(s)	14, 560, 1069
NspI	RCATGY	2 cut(s)	1101, 1115
PagI	TCATGA	2 cut(s)	777, 943
PasI	CCCWGGG	1 cut(s)	994
PciI	ACATGT	2 cut(s)	1097, 1111
PfeI	GAWTC	2 cut(s)	480, 742
PkrI	GCNGC	2 cut(s)	54, 597
PleI	GAGTC	5 cut(s)	41, 864, 941, 1076, 1123
PpsI	GAGTC	5 cut(s)	41, 864, 941, 1076, 1123
PscI	ACATGT	2 cut(s)	1097, 1111
Psp6I	CCWGG	1 cut(s)	993
PspGI	CCWGG	1 cut(s)	993
PspN4I	GGNNCC	4 cut(s)	66, 397, 532, 654
PspPI	GGNCC	1 cut(s)	752
PstI	CTGCAG	1 cut(s)	760
PvuII	CAGCTG	1 cut(s)	332
RsaI	GTAC	1 cut(s)	643
RsaNI	GTAC	1 cut(s)	642
RseI	CAYNNNNRTG	3 cut(s)	390, 801, 934
SaqAI	TTAA	1 cut(s)	636
SatI	GCNGC	2 cut(s)	53, 596
Sau3AI	GATC	5 cut(s)	217, 260, 461, 514, 727
Sau96I	GGNCC	1 cut(s)	752
SchI	GAGTC	5 cut(s)	41, 865, 941, 1077, 1123
ScrFI	CCNGG	1 cut(s)	995
SduI	GDGCHC	2 cut(s)	525, 943
SfaNI	GCATC	3 cut(s)	259, 304, 805
SfcI	CTRYAG	2 cut(s)	756, 1063
SinI	GGWCC	1 cut(s)	752
SmiMI	CAYNNNNRTG	3 cut(s)	390, 801, 934
SmlI	CTYRAG	2 cut(s)	201, 344
SmoI	CTYRAG	2 cut(s)	201, 344
Sse9I	AATT	8 cut(s)	20, 42, 351, 556, 626, 814, 849, 1090
SsiI	CCGC	2 cut(s)	320, 403
SspMI	CTAG	3 cut(s)	57, 377, 860
StyD4I	CCNGG	1 cut(s)	993
StyI	CCWWGG	1 cut(s)	660
TaaI	ACNGT	5 cut(s)	36, 448, 614, 634, 902
TaqI	TCGA	4 cut(s)	110, 230, 914, 1119
TasI	AATT	8 cut(s)	20, 42, 351, 556, 626, 814, 849, 1090
TfiI	GAWTC	2 cut(s)	480, 742
Tru1I	TTAA	1 cut(s)	636
Tru9I	TTAA	1 cut(s)	636
TscAI	CASTG	5 cut(s)	619, 889, 907, 1060, 1091
TseFI	GTSAC	3 cut(s)	14, 560, 1069
TseI	GCWGC	2 cut(s)	52, 595
Tsp45I	GTSAC	3 cut(s)	14, 560, 1069
TspDTI	ATGAA	6 cut(s)	110, 288, 471, 501, 563, 918
TspRI	CASTG	5 cut(s)	619, 889, 907, 1060, 1091
VpaK11BI	GGWCC	1 cut(s)	752
XagI	CCTNNNNNAGG	2 cut(s)	456, 841
XapI	RAATTY	1 cut(s)	626
XbaI	TCTAGA	1 cut(s)	859
XceI	RCATGY	2 cut(s)	1101, 1115
XcmI	CCANNNNNNNNNTGG	1 cut(s)	113
XspI	CTAG	3 cut(s)	57, 377, 860

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.