Rmu_sc0011992.1_g000006

Protein of unknown function (DUF751)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011992.1
Physical Location & Seq
Forward (+)
25565 .. 26155
591 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011992.1_g000006.1.cds

Sequence Viewer

Length: 591 bp
atgtccacactgagcagctcccaattacacctcttgaaatgcaccgctaccactctagcaaaatcaacctcctcatcaaatccttcatatcggtttctcaatcccatctcatcatcacaacaaaaacaccctccttcatatccaactatatcagcagcatctttacctgctagaaaatgcaacattggaaaagccagtagtcccaaatgccttgaaaagtcatccaaaatttctacacgagttgataatgggagcttacaatcatccaggtttttgataatgggagctgtttctgtaggagttgcgatgctgctgatggggattgatgatcagcaaaaggcaatggctttgggaccagaaggtccactgatggaagagttttgggacaatgtaaggagatatgcactgtatgctctcacagtgagtacaggtgctctctacactgtcttcctccctatatacgagttgttgaagaatcccatctctgcagttctcgtcttggtcattttaggtggaagtttcttcgttcttacccaagtcgtttcagccatgattggtgccacagactttgattatcaataccaatattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

196

Amino Acids

21.22

Weight (kDa)

9.13

Isoelectric Point (pI)

43.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015477)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 360
Acc36I ACCTGC 1 cut(s) 175
AccB1I GGYRCC 1 cut(s) 557
AciI CCGC 1 cut(s) 45
AcsI RAATTY 1 cut(s) 228
AfaI GTAC 1 cut(s) 427
AgsI TTSAA 3 cut(s) 37, 215, 472
AjnI CCWGG 1 cut(s) 266
AluBI AGCT 3 cut(s) 18, 255, 287
AluI AGCT 3 cut(s) 18, 255, 287
Alw21I GWGCWC 1 cut(s) 436
ApeKI GCWGC 3 cut(s) 15, 155, 310
ApoI RAATTY 1 cut(s) 228
AspS9I GGNCC 2 cut(s) 353, 362
AvaII GGWCC 2 cut(s) 353, 362
BanI GGYRCC 1 cut(s) 557
BauI CACGAG 1 cut(s) 237
BbsI GAAGAC 1 cut(s) 439
Bbv12I GWGCWC 1 cut(s) 436
BbvI GCAGC 3 cut(s) 27, 167, 297
BccI CCATC 4 cut(s) 113, 310, 364, 488
BciT130I CCWGG 1 cut(s) 268
BclI TGATCA 1 cut(s) 328
BfaI CTAG 2 cut(s) 56, 171
BfmI CTRYAG 2 cut(s) 294, 486
BfuAI ACCTGC 1 cut(s) 175
BisI GCNGC 3 cut(s) 16, 156, 311
BlsI GCNGC 3 cut(s) 17, 157, 312
Bme1390I CCNGG 1 cut(s) 268
Bme18I GGWCC 2 cut(s) 353, 362
BmgT120I GGNCC 2 cut(s) 353, 362
BmiI GGNNCC 2 cut(s) 354, 559
BmrFI CCNGG 1 cut(s) 268
BmsI GCATC 2 cut(s) 167, 297
BpiI GAAGAC 1 cut(s) 439
Bse1I ACTGG 1 cut(s) 195
Bse3DI GCAATG 1 cut(s) 348
BseBI CCWGG 1 cut(s) 268
BseGI GGATG 2 cut(s) 221, 263
BseMI GCAATG 1 cut(s) 348
BseNI ACTGG 1 cut(s) 195
BseRI GAGGAG 1 cut(s) 61
BseXI GCAGC 3 cut(s) 27, 167, 297
BshNI GGYRCC 1 cut(s) 557
BsiHKAI GWGCWC 1 cut(s) 436
BslFI GGGAC 3 cut(s) 186, 366, 398
BsmFI GGGAC 3 cut(s) 186, 366, 398
Bsp1286I GDGCHC 1 cut(s) 436
Bsp143I GATC 1 cut(s) 328
BspACI CCGC 1 cut(s) 45
BspLI GGNNCC 2 cut(s) 354, 559
BspMAI CTGCAG 1 cut(s) 490
BspMI ACCTGC 1 cut(s) 175
BspT107I GGYRCC 1 cut(s) 557
BsrDI GCAATG 1 cut(s) 348
BsrI ACTGG 1 cut(s) 195
BssMI GATC 1 cut(s) 328
BssSI CACGAG 1 cut(s) 237
Bst2BI CACGAG 1 cut(s) 237
Bst2UI CCWGG 1 cut(s) 268
Bst4CI ACNGT 3 cut(s) 408, 421, 445
Bst6I CTCTTC 1 cut(s) 369
BstAPI GCANNNNNTGC 1 cut(s) 410
BstDEI CTNAG 1 cut(s) 11
BstF5I GGATG 2 cut(s) 221, 263
BstKTI GATC 1 cut(s) 331
BstMBI GATC 1 cut(s) 328
BstMWI GCNNNNNNNGC 1 cut(s) 410
BstNI CCWGG 1 cut(s) 268
BstSCI CCNGG 1 cut(s) 266
BstSFI CTRYAG 2 cut(s) 294, 486
BstV1I GCAGC 3 cut(s) 27, 167, 297
BstV2I GAAGAC 1 cut(s) 439
BtgZI GCGATG 1 cut(s) 320
BtsCI GGATG 2 cut(s) 221, 263
BtsIMutI CAGTG 5 cut(s) 8, 365, 404, 426, 441
BveI ACCTGC 1 cut(s) 175
Cfr13I GGNCC 2 cut(s) 353, 362
Csp6I GTAC 1 cut(s) 426
CspCI CAANNNNNGTGG 2 cut(s) 550, 585
CviAII CATG 1 cut(s) 550
CviJI RGCY 6 cut(s) 18, 194, 255, 287, 347, 548
CviKI_1 RGCY 6 cut(s) 18, 194, 255, 287, 347, 548
CviQI GTAC 1 cut(s) 426
DdeI CTNAG 1 cut(s) 11
DpnI GATC 1 cut(s) 330
DpnII GATC 1 cut(s) 328
DrdI GACNNNNNNGTC 1 cut(s) 360
DseDI GACNNNNNNGTC 1 cut(s) 360
Eam1104I CTCTTC 1 cut(s) 369
EarI CTCTTC 1 cut(s) 369
Eco47I GGWCC 2 cut(s) 353, 362
EcoRII CCWGG 1 cut(s) 266
FaeI CATG 1 cut(s) 553
FaiI YATR 8 cut(s) 88, 139, 149, 402, 411, 458, 460, 551
FaqI GGGAC 3 cut(s) 186, 366, 398
FatI CATG 1 cut(s) 549
FbaI TGATCA 1 cut(s) 328
Fnu4HI GCNGC 3 cut(s) 16, 156, 311
FokI GGATG 2 cut(s) 208, 250
Fsp4HI GCNGC 3 cut(s) 16, 156, 311
FspBI CTAG 2 cut(s) 56, 171
GluI GCNGC 3 cut(s) 16, 156, 311
Hin1II CATG 1 cut(s) 553
HinfI GANTC 1 cut(s) 475
Hpy166II GTNNAC 2 cut(s) 6, 365
Hpy188III TCNNGA 1 cut(s) 34
Hpy8I GTNNAC 2 cut(s) 6, 365
HpyAV CCTTC 3 cut(s) 93, 144, 353
HpyCH4III ACNGT 3 cut(s) 408, 421, 445
HpyCH4V TGCA 4 cut(s) 42, 180, 404, 488
HpyF10VI GCNNNNNNNGC 1 cut(s) 410
HpyF3I CTNAG 1 cut(s) 11
Hsp92II CATG 1 cut(s) 553
Ksp22I TGATCA 1 cut(s) 328
Kzo9I GATC 1 cut(s) 328
LmnI GCTCC 3 cut(s) 23, 252, 284
LpnPI CCDG 6 cut(s) 180, 208, 253, 280, 369, 414
Lsp1109I GCAGC 3 cut(s) 27, 167, 297
LweI GCATC 2 cut(s) 167, 297
MaeI CTAG 2 cut(s) 56, 171
MalI GATC 1 cut(s) 330
MboI GATC 1 cut(s) 328
MboII GAAGA 4 cut(s) 386, 439, 484, 514
MhlI GDGCHC 1 cut(s) 436
MluCI AATT 2 cut(s) 23, 228
MmeI TCCRAC 1 cut(s) 167
MnlI CCTC 5 cut(s) 41, 79, 82, 141, 461
MseI TTAA 1 cut(s) 589
MspR9I CCNGG 1 cut(s) 268
MvaI CCWGG 1 cut(s) 268
MwoI GCNNNNNNNGC 1 cut(s) 410
NdeII GATC 1 cut(s) 328
NlaIII CATG 1 cut(s) 553
NlaIV GGNNCC 2 cut(s) 354, 559
PfeI GAWTC 1 cut(s) 475
PkrI GCNGC 3 cut(s) 17, 157, 312
Psp6I CCWGG 1 cut(s) 266
PspGI CCWGG 1 cut(s) 266
PspN4I GGNNCC 2 cut(s) 354, 559
PspPI GGNCC 2 cut(s) 353, 362
PstI CTGCAG 1 cut(s) 490
RsaI GTAC 1 cut(s) 427
RsaNI GTAC 1 cut(s) 426
SaqAI TTAA 1 cut(s) 589
SatI GCNGC 3 cut(s) 16, 156, 311
Sau3AI GATC 1 cut(s) 328
Sau96I GGNCC 2 cut(s) 353, 362
ScrFI CCNGG 1 cut(s) 268
SduI GDGCHC 1 cut(s) 436
SfaNI GCATC 2 cut(s) 167, 297
SfcI CTRYAG 2 cut(s) 294, 486
SinI GGWCC 2 cut(s) 353, 362
Sse9I AATT 2 cut(s) 23, 228
SsiI CCGC 1 cut(s) 45
SspI AATATT 1 cut(s) 587
SspMI CTAG 2 cut(s) 56, 171
StyD4I CCNGG 1 cut(s) 266
TaaI ACNGT 3 cut(s) 408, 421, 445
TasI AATT 2 cut(s) 23, 228
TatI WGTACW 1 cut(s) 425
TfiI GAWTC 1 cut(s) 475
Tru1I TTAA 1 cut(s) 589
Tru9I TTAA 1 cut(s) 589
TscAI CASTG 5 cut(s) 15, 372, 411, 426, 448
TseI GCWGC 3 cut(s) 15, 155, 310
TspDTI ATGAA 2 cut(s) 75, 126
TspRI CASTG 5 cut(s) 15, 372, 411, 426, 448
VpaK11BI GGWCC 2 cut(s) 353, 362
XapI RAATTY 1 cut(s) 228
XspI CTAG 2 cut(s) 56, 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.