Rmu_sc0014337.1_g000002

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014337.1
OG0016331
Physical Location & Seq
Reverse (-)
7571 .. 8296
726 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014337.1_g000002.1.cds

Sequence Viewer

Length: 726 bp
atggaaagcctaaaggcaaatgaccctagtgttaaaagtcctcaagtggagaagctacaagaccagttcatgaatttgcaacaagagtggaagtcatacaaacagtcctaccccaaaaccaagaggagatcatattcttcatcatcaagcaccatggccaaaacccgatcaaggcacctcatgtcttcacctcagcacagaatgtttccctcggaaggcgataattggaatgtcaggactaatgatcttgcagtggaagagatcagaagagaccgaagggcggcgattgagagtggcaagttgaaggggaggaggctgtttgaggatgagcatgaagaaactgagattggttatggaggagaagagagtgaatggggtagctgggatgattgggatcaggagagtgaggtgagatcacttccattatgtggttctggtggtgaagaagttgaatcaggtaagagtaaagagattaaagtttgttttcaggattccatttcatctttgacctcttccccatgtggtgagaaaatgaaggaagaagagaaactggtgactgtggaagagaaggaggttgttgagaataaagggggtaattgggtaaggtgcattgttgtgatcatgcctgtgattgccattgctgcacttatatttgcaatttgcagtatcacgggtctttatggatatgggaatgaacattatgagctaattctagtcccaacgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

241

Amino Acids

27.38

Weight (kDa)

5.18

Isoelectric Point (pI)

74.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016331)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g08620
malus_domestica MD06G1138600.v1.1 MD14G1154600.v1.1
prunus_persica Prupe.5G148800_v2.0.a1
rosa_chinensis RchiOBHm_Chr7g0189791
rosa_laevigata RLG00000004590
rosa_multiflora Rmu_sc0014337.1_g000002 Rmu_sc0029387.1_g000002
rosa_roxburghii Rroxscaffold_3G00265160
rosa_rugosa Rorug06G0499900
rosa_samantha Rh7AG105000 Rh7BG107600 Rh7CG109600 Rh7DG108000
rosa_wichuraiana Rw7G009090

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 174
AccB7I CCANNNNNTGG 1 cut(s) 428
AciI CCGC 1 cut(s) 281
AclWI GGATC 1 cut(s) 402
AcoI YGGCCR 1 cut(s) 156
AcsI RAATTY 1 cut(s) 73
AfiI CCNNNNNNNGG 4 cut(s) 171, 215, 280, 428
AgsI TTSAA 2 cut(s) 304, 452
AjuI GAANNNNNNNTTGG 2 cut(s) 330, 362
AluBI AGCT 3 cut(s) 55, 381, 706
AluI AGCT 3 cut(s) 55, 381, 706
Alw26I GTCTC 1 cut(s) 264
AlwI GGATC 1 cut(s) 402
AoxI GGCC 1 cut(s) 156
ApeKI GCWGC 1 cut(s) 641
ApoI RAATTY 1 cut(s) 73
AsuHPI GGTGA 5 cut(s) 180, 421, 452, 536, 565
BalI TGGCCA 1 cut(s) 158
BanI GGYRCC 1 cut(s) 174
BbsI GAAGAC 1 cut(s) 177
BbvCI CCTCAGC 1 cut(s) 192
BbvI GCAGC 1 cut(s) 628
BclI TGATCA 1 cut(s) 618
BcoDI GTCTC 1 cut(s) 264
BfaI CTAG 2 cut(s) 27, 713
BisI GCNGC 2 cut(s) 282, 642
BlsI GCNGC 2 cut(s) 283, 643
BmiI GGNNCC 1 cut(s) 176
BpiI GAAGAC 1 cut(s) 177
Bpu10I CCTNAGC 1 cut(s) 192
BpuEI CTTGAG 1 cut(s) 27
BsaBI GATNNNNATC 1 cut(s) 393
BsaI GGTCTC 1 cut(s) 264
BsaJI CCNNGG 2 cut(s) 153, 210
Bsc4I CCNNNNNNNGG 4 cut(s) 171, 215, 280, 428
Bse1I ACTGG 2 cut(s) 64, 555
Bse3DI GCAATG 1 cut(s) 636
Bse8I GATNNNNATC 1 cut(s) 393
BseDI CCNNGG 2 cut(s) 153, 210
BseGI GGATG 2 cut(s) 331, 391
BseJI GATNNNNATC 1 cut(s) 393
BseLI CCNNNNNNNGG 4 cut(s) 171, 215, 280, 428
BseMI GCAATG 1 cut(s) 636
BseMII CTCAG 2 cut(s) 206, 333
BseNI ACTGG 2 cut(s) 64, 555
BseRI GAGGAG 3 cut(s) 139, 325, 372
BseXI GCAGC 1 cut(s) 628
BseYI CCCAGC 1 cut(s) 381
BsgI GTGCAG 1 cut(s) 627
BshFI GGCC 1 cut(s) 158
BshNI GGYRCC 1 cut(s) 174
BslFI GGGAC 1 cut(s) 701
BslI CCNNNNNNNGG 4 cut(s) 171, 215, 280, 428
BsmAI GTCTC 1 cut(s) 264
BsmFI GGGAC 1 cut(s) 701
BsnI GGCC 1 cut(s) 158
Bso31I GGTCTC 1 cut(s) 264
Bsp143I GATC 7 cut(s) 128, 167, 244, 261, 394, 413, 618
Bsp19I CCATGG 1 cut(s) 153
BspACI CCGC 1 cut(s) 281
BspANI GGCC 1 cut(s) 158
BspCNI CTCAG 2 cut(s) 205, 334
BspHI TCATGA 1 cut(s) 69
BspLI GGNNCC 1 cut(s) 176
BspPI GGATC 1 cut(s) 402
BspT107I GGYRCC 1 cut(s) 174
BspTNI GGTCTC 1 cut(s) 264
BsrDI GCAATG 1 cut(s) 636
BsrI ACTGG 2 cut(s) 64, 555
BssECI CCNNGG 2 cut(s) 153, 210
BssMI GATC 7 cut(s) 128, 167, 244, 261, 394, 413, 618
BssT1I CCWWGG 1 cut(s) 153
Bst4CI ACNGT 2 cut(s) 105, 559
Bst6I CTCTTC 6 cut(s) 252, 262, 357, 517, 537, 558
BstDEI CTNAG 2 cut(s) 192, 342
BstDSI CCRYGG 1 cut(s) 153
BstF5I GGATG 2 cut(s) 331, 391
BstKTI GATC 7 cut(s) 131, 170, 247, 264, 397, 416, 621
BstMAI GTCTC 1 cut(s) 264
BstMBI GATC 7 cut(s) 128, 167, 244, 261, 394, 413, 618
BstMWI GCNNNNNNNGC 1 cut(s) 641
BstV1I GCAGC 1 cut(s) 628
BstV2I GAAGAC 1 cut(s) 177
BsuRI GGCC 1 cut(s) 158
BtgI CCRYGG 1 cut(s) 153
BtsCI GGATG 2 cut(s) 331, 391
BtsI GCAGTG 1 cut(s) 258
BtsIMutI CAGTG 1 cut(s) 258
CciI TCATGA 1 cut(s) 69
CspCI CAANNNNNGTGG 2 cut(s) 68, 103
CviAII CATG 6 cut(s) 70, 154, 181, 332, 519, 622
CviJI RGCY 6 cut(s) 9, 55, 158, 316, 381, 706
CviKI_1 RGCY 6 cut(s) 9, 55, 158, 316, 381, 706
DdeI CTNAG 2 cut(s) 192, 342
DpnI GATC 7 cut(s) 130, 169, 246, 263, 396, 415, 620
DpnII GATC 7 cut(s) 128, 167, 244, 261, 394, 413, 618
EaeI YGGCCR 1 cut(s) 156
Eam1104I CTCTTC 6 cut(s) 252, 262, 357, 517, 537, 558
EarI CTCTTC 6 cut(s) 252, 262, 357, 517, 537, 558
Eco130I CCWWGG 1 cut(s) 153
Eco31I GGTCTC 1 cut(s) 264
EcoT14I CCWWGG 1 cut(s) 153
ErhI CCWWGG 1 cut(s) 153
FaeI CATG 6 cut(s) 73, 157, 184, 335, 522, 625
FaqI GGGAC 1 cut(s) 701
FatI CATG 6 cut(s) 69, 153, 180, 331, 518, 621
FbaI TGATCA 1 cut(s) 618
Fnu4HI GCNGC 2 cut(s) 282, 642
FokI GGATG 2 cut(s) 338, 398
Fsp4HI GCNGC 2 cut(s) 282, 642
FspBI CTAG 2 cut(s) 27, 713
GluI GCNGC 2 cut(s) 282, 642
GsaI CCCAGC 1 cut(s) 385
HaeIII GGCC 1 cut(s) 158
Hin1II CATG 6 cut(s) 73, 157, 184, 335, 522, 625
HinfI GANTC 2 cut(s) 452, 491
HphI GGTGA 5 cut(s) 180, 421, 452, 536, 565
Hpy188I TCNGA 2 cut(s) 214, 266
Hpy188III TCNNGA 4 cut(s) 70, 235, 398, 488
HpyAV CCTTC 5 cut(s) 209, 270, 298, 529, 562
HpyCH4III ACNGT 2 cut(s) 105, 559
HpyCH4IV ACGT 1 cut(s) 722
HpyCH4V TGCA 6 cut(s) 79, 251, 609, 644, 656, 663
HpyF10VI GCNNNNNNNGC 1 cut(s) 641
HpyF3I CTNAG 2 cut(s) 192, 342
HpySE526I ACGT 1 cut(s) 722
Hsp92II CATG 6 cut(s) 73, 157, 184, 335, 522, 625
Ksp22I TGATCA 1 cut(s) 618
Kzo9I GATC 7 cut(s) 128, 167, 244, 261, 394, 413, 618
LpnPI CCDG 9 cut(s) 77, 220, 367, 383, 420, 441, 473, 536, 639
Lsp1109I GCAGC 1 cut(s) 628
MaeI CTAG 2 cut(s) 27, 713
MaeII ACGT 1 cut(s) 722
MaeIII GTNAC 1 cut(s) 553
MalI GATC 7 cut(s) 130, 169, 246, 263, 396, 415, 620
MboI GATC 7 cut(s) 128, 167, 244, 261, 394, 413, 618
MlsI TGGCCA 1 cut(s) 158
MluCI AATT 5 cut(s) 73, 223, 595, 657, 708
MluNI TGGCCA 1 cut(s) 158
Mox20I TGGCCA 1 cut(s) 158
MscI TGGCCA 1 cut(s) 158
MseI TTAA 2 cut(s) 33, 474
MslI CAYNNNNRTG 2 cut(s) 614, 626
Msp20I TGGCCA 1 cut(s) 158
MwoI GCNNNNNNNGC 1 cut(s) 641
NcoI CCATGG 1 cut(s) 153
NdeII GATC 7 cut(s) 128, 167, 244, 261, 394, 413, 618
NlaIII CATG 6 cut(s) 73, 157, 184, 335, 522, 625
NlaIV GGNNCC 1 cut(s) 176
NmuCI GTSAC 1 cut(s) 553
PagI TCATGA 1 cut(s) 69
PfeI GAWTC 2 cut(s) 452, 491
PflMI CCANNNNNTGG 1 cut(s) 428
PkrI GCNGC 2 cut(s) 283, 643
PspFI CCCAGC 1 cut(s) 381
PspN4I GGNNCC 1 cut(s) 176
RseI CAYNNNNRTG 2 cut(s) 614, 626
SaqAI TTAA 2 cut(s) 33, 474
SatI GCNGC 2 cut(s) 282, 642
Sau3AI GATC 7 cut(s) 128, 167, 244, 261, 394, 413, 618
SmiMI CAYNNNNRTG 2 cut(s) 614, 626
SmlI CTYRAG 1 cut(s) 42
SmoI CTYRAG 1 cut(s) 42
Sse9I AATT 5 cut(s) 73, 223, 595, 657, 708
SsiI CCGC 1 cut(s) 281
SspMI CTAG 2 cut(s) 27, 713
StyI CCWWGG 1 cut(s) 153
TaaI ACNGT 2 cut(s) 105, 559
TaiI ACGT 1 cut(s) 725
TaqII GACCGA 1 cut(s) 288
TasI AATT 5 cut(s) 73, 223, 595, 657, 708
TauI GCSGC 1 cut(s) 284
TfiI GAWTC 2 cut(s) 452, 491
Tru1I TTAA 2 cut(s) 33, 474
Tru9I TTAA 2 cut(s) 33, 474
TscAI CASTG 1 cut(s) 258
TseFI GTSAC 1 cut(s) 553
TseI GCWGC 1 cut(s) 641
Tsp45I GTSAC 1 cut(s) 553
TspDTI ATGAA 7 cut(s) 58, 86, 129, 348, 489, 548, 708
TspRI CASTG 1 cut(s) 258
Van91I CCANNNNNTGG 1 cut(s) 428
XapI RAATTY 1 cut(s) 73
XspI CTAG 2 cut(s) 27, 713
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.