Rmu_sc0014404.1_g000002

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014404.1
OG0019882
Physical Location & Seq
Reverse (-)
2311 .. 2691
381 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014404.1_g000002.1.cds

Sequence Viewer

Length: 381 bp
atgtcgaagctcactcaacaatccctacctatactaccactactagttttggtttttgccagaagtttagctaaagctagtgatctcaaagaaacccaattagtcttgtacttccaggatttcactgcaggtccaaatacctcaagcataccagttgcaggcatcgctggaaagctgtggaccttcactcaattcggaacaatttatgtcaccgatgacaccatgacccaaggaccgaacataacatcttccgtagtaggacgggcccaaggcataacggtggcatcggcactggacggaagcaatgcccttgtcttggtgtctcgtgttcacaaacatgaagtacaatggcagcactctagagatacaaggaaacagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

126

Amino Acids

13.71

Weight (kDa)

9.52

Isoelectric Point (pI)

31.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019882)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0158841
rosa_multiflora Rmu_sc0014404.1_g000002
rosa_rugosa Rorug02G0473000
rosa_samantha Rh2AG538900 Rh2BG551500 Rh2CG522200 Rh2DG561300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 119
AfaI GTAC 2 cut(s) 110, 345
AfiI CCNNNNNNNGG 2 cut(s) 158, 316
AhlI ACTAGT 1 cut(s) 43
AjnI CCWGG 1 cut(s) 114
AluBI AGCT 4 cut(s) 10, 71, 77, 175
AluI AGCT 4 cut(s) 10, 71, 77, 175
Alw26I GTCTC 1 cut(s) 327
AoxI GGCC 1 cut(s) 264
ApaI GGGCCC 1 cut(s) 268
ApeKI GCWGC 1 cut(s) 352
AspS9I GGNCC 5 cut(s) 131, 180, 233, 264, 265
AsuHPI GGTGA 1 cut(s) 202
AvaII GGWCC 3 cut(s) 131, 180, 233
BaeGI GKGCMC 1 cut(s) 268
BanII GRGCYC 1 cut(s) 268
BauI CACGAG 1 cut(s) 324
BbvI GCAGC 1 cut(s) 364
BciT130I CCWGG 1 cut(s) 116
BcoDI GTCTC 1 cut(s) 327
BcuI ACTAGT 1 cut(s) 43
BfaI CTAG 3 cut(s) 44, 78, 360
BfmI CTRYAG 1 cut(s) 126
BfuAI ACCTGC 1 cut(s) 119
BisI GCNGC 1 cut(s) 353
BlsI GCNGC 1 cut(s) 354
Bme1390I CCNGG 1 cut(s) 116
Bme18I GGWCC 3 cut(s) 131, 180, 233
BmgT120I GGNCC 5 cut(s) 131, 180, 233, 264, 265
BmiI GGNNCC 1 cut(s) 266
BmrFI CCNGG 1 cut(s) 116
BmsI GCATC 2 cut(s) 171, 293
BpuEI CTTGAG 1 cut(s) 127
BsaJI CCNNGG 2 cut(s) 229, 268
Bsc4I CCNNNNNNNGG 2 cut(s) 158, 316
Bse1I ACTGG 2 cut(s) 152, 297
Bse3DI GCAATG 1 cut(s) 310
BseBI CCWGG 1 cut(s) 116
BseDI CCNNGG 2 cut(s) 229, 268
BseLI CCNNNNNNNGG 2 cut(s) 158, 316
BseMI GCAATG 1 cut(s) 310
BseNI ACTGG 2 cut(s) 152, 297
BseSI GKGCMC 1 cut(s) 268
BseXI GCAGC 1 cut(s) 364
BshFI GGCC 1 cut(s) 266
BslI CCNNNNNNNGG 2 cut(s) 158, 316
BsmAI GTCTC 1 cut(s) 327
BsnI GGCC 1 cut(s) 266
Bsp120I GGGCCC 1 cut(s) 264
Bsp1286I GDGCHC 1 cut(s) 268
Bsp143I GATC 1 cut(s) 82
BspANI GGCC 1 cut(s) 266
BspLI GGNNCC 1 cut(s) 266
BspMAI CTGCAG 1 cut(s) 130
BspMI ACCTGC 1 cut(s) 119
BsrDI GCAATG 1 cut(s) 310
BsrI ACTGG 2 cut(s) 152, 297
BssECI CCNNGG 2 cut(s) 229, 268
BssMI GATC 1 cut(s) 82
BssSI CACGAG 1 cut(s) 324
BssT1I CCWWGG 2 cut(s) 229, 268
Bst2BI CACGAG 1 cut(s) 324
Bst2UI CCWGG 1 cut(s) 116
Bst4CI ACNGT 2 cut(s) 280, 378
BstC8I GCNNGC 1 cut(s) 160
BstKTI GATC 1 cut(s) 85
BstMAI GTCTC 1 cut(s) 327
BstMBI GATC 1 cut(s) 82
BstMWI GCNNNNNNNGC 1 cut(s) 164
BstNI CCWGG 1 cut(s) 116
BstSCI CCNGG 1 cut(s) 114
BstSFI CTRYAG 1 cut(s) 126
BstSLI GKGCMC 1 cut(s) 268
BstV1I GCAGC 1 cut(s) 364
BsuRI GGCC 1 cut(s) 266
BtgZI GCGATG 1 cut(s) 148
BtsI GCAGTG 1 cut(s) 123
BtsIMutI CAGTG 2 cut(s) 123, 290
BveI ACCTGC 1 cut(s) 119
Cac8I GCNNGC 1 cut(s) 160
Cfr13I GGNCC 5 cut(s) 131, 180, 233, 264, 265
Csp6I GTAC 2 cut(s) 109, 344
CviAII CATG 2 cut(s) 223, 338
CviJI RGCY 5 cut(s) 10, 71, 77, 175, 266
CviKI_1 RGCY 5 cut(s) 10, 71, 77, 175, 266
CviQI GTAC 2 cut(s) 109, 344
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
Eco130I CCWWGG 2 cut(s) 229, 268
Eco24I GRGCYC 1 cut(s) 268
Eco47I GGWCC 3 cut(s) 131, 180, 233
EcoRII CCWGG 1 cut(s) 114
EcoT14I CCWWGG 2 cut(s) 229, 268
EcoT38I GRGCYC 1 cut(s) 268
ErhI CCWWGG 2 cut(s) 229, 268
FaeI CATG 2 cut(s) 226, 341
FaiI YATR 7 cut(s) 32, 149, 207, 224, 242, 275, 339
FatI CATG 2 cut(s) 222, 337
Fnu4HI GCNGC 1 cut(s) 353
FriOI GRGCYC 1 cut(s) 268
Fsp4HI GCNGC 1 cut(s) 353
FspBI CTAG 3 cut(s) 44, 78, 360
GluI GCNGC 1 cut(s) 353
HaeIII GGCC 1 cut(s) 266
Hin1II CATG 2 cut(s) 226, 341
HphI GGTGA 1 cut(s) 202
Hpy166II GTNNAC 2 cut(s) 180, 331
Hpy188I TCNGA 1 cut(s) 197
Hpy188III TCNNGA 1 cut(s) 360
Hpy8I GTNNAC 2 cut(s) 180, 331
HpyAV CCTTC 1 cut(s) 193
HpyCH4III ACNGT 2 cut(s) 280, 378
HpyCH4V TGCA 2 cut(s) 128, 158
HpyF10VI GCNNNNNNNGC 1 cut(s) 164
Hsp92II CATG 2 cut(s) 226, 341
Kzo9I GATC 1 cut(s) 82
LpnPI CCDG 8 cut(s) 73, 101, 114, 128, 144, 153, 165, 278
Lsp1109I GCAGC 1 cut(s) 364
LweI GCATC 2 cut(s) 171, 293
MaeI CTAG 3 cut(s) 44, 78, 360
MaeIII GTNAC 1 cut(s) 208
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MboII GAAGA 1 cut(s) 240
MhlI GDGCHC 1 cut(s) 268
MluCI AATT 3 cut(s) 98, 191, 201
MnlI CCTC 1 cut(s) 151
MslI CAYNNNNRTG 2 cut(s) 278, 336
MspR9I CCNGG 1 cut(s) 116
MvaI CCWGG 1 cut(s) 116
MwoI GCNNNNNNNGC 1 cut(s) 164
NdeII GATC 1 cut(s) 82
NlaIII CATG 2 cut(s) 226, 341
NlaIV GGNNCC 1 cut(s) 266
NmuCI GTSAC 1 cut(s) 208
PfoI TCCNGGA 1 cut(s) 114
PkrI GCNGC 1 cut(s) 354
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
PspN4I GGNNCC 1 cut(s) 266
PspOMI GGGCCC 1 cut(s) 264
PspPI GGNCC 5 cut(s) 131, 180, 233, 264, 265
PstI CTGCAG 1 cut(s) 130
RsaI GTAC 2 cut(s) 110, 345
RsaNI GTAC 2 cut(s) 109, 344
RseI CAYNNNNRTG 2 cut(s) 278, 336
SatI GCNGC 1 cut(s) 353
Sau3AI GATC 1 cut(s) 82
Sau96I GGNCC 5 cut(s) 131, 180, 233, 264, 265
ScrFI CCNGG 1 cut(s) 116
SduI GDGCHC 1 cut(s) 268
SetI ASST 8 cut(s) 12, 31, 73, 79, 133, 143, 177, 185
SfaNI GCATC 2 cut(s) 171, 293
SfcI CTRYAG 1 cut(s) 126
SinI GGWCC 3 cut(s) 131, 180, 233
SmiMI CAYNNNNRTG 2 cut(s) 278, 336
SmlI CTYRAG 1 cut(s) 142
SmoI CTYRAG 1 cut(s) 142
SpeI ACTAGT 1 cut(s) 43
Sse9I AATT 3 cut(s) 98, 191, 201
SspMI CTAG 3 cut(s) 44, 78, 360
StyD4I CCNGG 1 cut(s) 114
StyI CCWWGG 2 cut(s) 229, 268
TaaI ACNGT 2 cut(s) 280, 378
TaqI TCGA 1 cut(s) 5
TaqII GACCGA 1 cut(s) 250
TasI AATT 3 cut(s) 98, 191, 201
TatI WGTACW 2 cut(s) 108, 343
TscAI CASTG 2 cut(s) 130, 297
TseFI GTSAC 1 cut(s) 208
TseI GCWGC 1 cut(s) 352
Tsp45I GTSAC 1 cut(s) 208
TspDTI ATGAA 1 cut(s) 354
TspGWI ACGGA 2 cut(s) 241, 312
TspRI CASTG 2 cut(s) 130, 297
VpaK11BI GGWCC 3 cut(s) 131, 180, 233
XbaI TCTAGA 1 cut(s) 359
XspI CTAG 3 cut(s) 44, 78, 360
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.