Rmu_sc0024549.1_g000005

U4 U6 small nuclear ribonucleoprotein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0024549.1
Physical Location & Seq
Reverse (-)
17038 .. 17394
357 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0024549.1_g000005.1.cds

Sequence Viewer

Length: 357 bp
atggatgcaacccttgttgatctggaggagcttgtatcttcaacaactattgtggatgtgtcagttacagcttcaactacaagtggaaagccgcttccagaggacatcttagagaaaatagttgatgcatgtgatcaagcccttgcactcgattcagcaaagaaacaagtttttgattttgtaaaagggagaatgggttctattgcaccaaatctttgtgctactgttgggagtgttgttgcggcaaaccttatggggacagctggtggtcttgctgccttaactaatatgcctgcttgtaatgttcagcttcttggtgttaagaaaaaagaatgggttttatatgcaggggattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

12.2

Weight (kDa)

4.53

Isoelectric Point (pI)

29.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019275)

Species Orthologous Gene IDs
malus_domestica MD15G1297300.v1.1
pyrus_communis pycom15g26040
rosa_laevigata RLG00000022097
rosa_multiflora Rmu_sc0024549.1_g000005 Rmu_sc0025855.1_g000002
rosa_rugosa Rorug02G0557900
rosa_samantha Rh2CG613500 Rh2DG661400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 92, 242
AgsI TTSAA 2 cut(s) 42, 75
AloI GAACNNNNNNTCC 2 cut(s) 181, 213
AluBI AGCT 4 cut(s) 31, 71, 263, 310
AluI AGCT 4 cut(s) 31, 71, 263, 310
ApeKI GCWGC 1 cut(s) 275
Asp700I GAANNNNTTC 1 cut(s) 196
BbvI GCAGC 1 cut(s) 262
BclI TGATCA 1 cut(s) 133
BisI GCNGC 3 cut(s) 92, 243, 276
BlsI GCNGC 3 cut(s) 93, 244, 277
BmsI GCATC 1 cut(s) 115
BpmI CTGGAG 1 cut(s) 44
BsaXI ACNNNNNCTCC 2 cut(s) 181, 211
BseGI GGATG 2 cut(s) 10, 61
BseRI GAGGAG 1 cut(s) 41
BseXI GCAGC 1 cut(s) 262
BslFI GGGAC 1 cut(s) 271
BsmFI GGGAC 1 cut(s) 271
Bsp143I GATC 2 cut(s) 19, 133
BspACI CCGC 2 cut(s) 92, 242
BssMI GATC 2 cut(s) 19, 133
Bst4CI ACNGT 1 cut(s) 226
BstC8I GCNNGC 1 cut(s) 294
BstDEI CTNAG 1 cut(s) 109
BstF5I GGATG 2 cut(s) 10, 61
BstKTI GATC 2 cut(s) 22, 136
BstMBI GATC 2 cut(s) 19, 133
BstNSI RCATGY 1 cut(s) 132
BstV1I GCAGC 1 cut(s) 262
BtsCI GGATG 2 cut(s) 10, 61
Cac8I GCNNGC 1 cut(s) 294
CspCI CAANNNNNGTGG 2 cut(s) 33, 68
CviAII CATG 1 cut(s) 129
CviJI RGCY 6 cut(s) 31, 71, 91, 140, 263, 310
CviKI_1 RGCY 6 cut(s) 31, 71, 91, 140, 263, 310
DdeI CTNAG 1 cut(s) 109
DpnI GATC 2 cut(s) 21, 135
DpnII GATC 2 cut(s) 19, 133
EcoT22I ATGCAT 1 cut(s) 130
FaeI CATG 1 cut(s) 132
FaiI YATR 5 cut(s) 130, 254, 290, 343, 345
FaqI GGGAC 1 cut(s) 271
FatI CATG 1 cut(s) 128
FbaI TGATCA 1 cut(s) 133
Fnu4HI GCNGC 3 cut(s) 92, 243, 276
FokI GGATG 2 cut(s) 17, 68
Fsp4HI GCNGC 3 cut(s) 92, 243, 276
GluI GCNGC 3 cut(s) 92, 243, 276
GsuI CTGGAG 1 cut(s) 44
Hin1II CATG 1 cut(s) 132
HinfI GANTC 1 cut(s) 152
Hpy188III TCNNGA 2 cut(s) 23, 98
HpyCH4III ACNGT 1 cut(s) 226
HpyCH4V TGCA 5 cut(s) 8, 128, 146, 206, 347
HpyF3I CTNAG 1 cut(s) 109
Hsp92II CATG 1 cut(s) 132
Ksp22I TGATCA 1 cut(s) 133
Kzo9I GATC 2 cut(s) 19, 133
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 5 cut(s) 8, 111, 249, 306, 333
Lsp1109I GCAGC 1 cut(s) 262
LweI GCATC 1 cut(s) 115
MaeIII GTNAC 1 cut(s) 64
MalI GATC 2 cut(s) 21, 135
MboI GATC 2 cut(s) 19, 133
MboII GAAGA 1 cut(s) 30
MnlI CCTC 2 cut(s) 19, 94
Mph1103I ATGCAT 1 cut(s) 130
MroXI GAANNNNTTC 1 cut(s) 196
MseI TTAA 2 cut(s) 281, 321
MspA1I CMGCKG 1 cut(s) 263
NdeII GATC 2 cut(s) 19, 133
NlaIII CATG 1 cut(s) 132
NsiI ATGCAT 1 cut(s) 130
NspI RCATGY 1 cut(s) 132
PdmI GAANNNNTTC 1 cut(s) 196
PfeI GAWTC 1 cut(s) 152
PkrI GCNGC 3 cut(s) 93, 244, 277
PvuII CAGCTG 1 cut(s) 263
SaqAI TTAA 2 cut(s) 281, 321
SatI GCNGC 3 cut(s) 92, 243, 276
Sau3AI GATC 2 cut(s) 19, 133
SetI ASST 5 cut(s) 33, 73, 252, 265, 312
SfaNI GCATC 1 cut(s) 115
SsiI CCGC 2 cut(s) 92, 242
TaaI ACNGT 1 cut(s) 226
TaqI TCGA 1 cut(s) 150
TauI GCSGC 2 cut(s) 94, 245
TfiI GAWTC 1 cut(s) 152
Tru1I TTAA 2 cut(s) 281, 321
Tru9I TTAA 2 cut(s) 281, 321
TseI GCWGC 1 cut(s) 275
XceI RCATGY 1 cut(s) 132
XmnI GAANNNNTTC 1 cut(s) 196
Zsp2I ATGCAT 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.